Tài liệu Báo cáo khoa học: "ASSIGNING A SEMANTIC SCOPE TO OPERATORS" ppt
Tài liệu Báo cáo khoa học: "ASSIGNING A SEMANTIC SCOPE TO OPERATORS" ppt
... student-nora every language-ace speak
c. Subete-no gengo-o hotondo-no gakusei-ga hanasu
every language-ace most-gen student-nora speak
d. Subete-no gengo-wa hotondo-no gakusei-ga hanasu
every language-TOP ... Parameters are used in SEL to trans-
late anaphoric expressions of English. A parameter behaves
semantically as an open variable, a value for which has to
be provided by c...
Tài liệu Báo cáo khoa học: "Towards a Computational Treatment of Superlatives" pptx
... IS -A relation that holds between target and
comparison set (cf. Relation 2 in Section 3). They
68
are a good initial focus for a computational ap-
proach because both their target and comparison ... su-
perlatives have mainly focused on particular se-
mantic properties that may only rarely occur in
natural language (Szabolcsi, 1986; Heim, 1999).
My goal is a comprehensive computat...
Tài liệu Báo cáo khoa học: "MATCHKiosk: A Multimodal Interactive City Guide" pptx
... find me moderately priced italian restaurants
in Alexandria, a multimodal combination of speech
and pen, e.g. moderate italian restaurants in this
area and circling Alexandria on the map, or solely
pen, ... MATCHKiosk: A Multimodal Interactive City Guide
Michael Johnston
AT&T Research
180 Park Avenue
Florham Park, NJ 07932
johnston@research.att.com
Srinivas Bangalore
AT&T Research...
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... H, Naka D, Takahashi K,
Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-
ama O, Takahashi K et al. (1989) Molecular cloning
and sequence analysis of cDNA for human hepatocyte
growth factor. ... factor activator
inhibitor type 1; HAI-2, hepatocyte growth factor activator inhibitor type 2; HGF, hepatocyte growth factor; HGFA, hepatocyte growth factor
activator; HPAI, highly pathogenic avian ....
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... (Hartmann Analytic, Braunschweig, Germany) was
added. The supernatants were extracted with XAD16 resin
after an additional 2 days of growth. The dried eluate was
dissolved in 10% methanol and analyzed ... nonribosomal peptide synthetases: the
emerging view from bacterial genomics. Nat Prod Rep
24, 1073–1109.
32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,
Naganawa H, Hamada M & Takeuc...
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... AGCTGATCTTCGAAGATCTTCGAAGAT
Mutated HSE
sense
Biotin-TCGACTT
CAAGCTTGTACAAGCTTGTAG
Mutated HSE
antisense
AGCTGAAGTTCGAACATGTTCGAACATC
‘Scrambled’
oligonucleotide
Biotin-AACGACGGTCGCTCCGCCTGGCT
140
40
60
80
100
120
Counts ... TransLISA, a novel quantitative, nonradioactive assay
for transcription factor DNA-binding analyses
Kristiina A. Vuori
1
, Johanna K. Ahlskog
2
, Lea Sistonen
2
and Mi...
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami
A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,
Hamasaki K et al. (2003) Interferon -a sensitizes human
hepatoma cells to TRAIL-induced apoptosis through
DR5 ... Leaman DW, Chawla-Sarkar M, Vyas K, Reheman M,
Tamai K, Toji S & Borden EC (2002) Identification of
X-linked inhibitor of apoptosis-associated factor-1 as an
interferon-stimulat...
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... 5¢-GGGAATTCCATATGAGAGACAATA
TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT
CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and
PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG
AATTCCATATGAAGAATGATCAATCTGGCTGCG
GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG
TTCCCTGTCCAGTGTTACC-3¢. ... African trypanosome
Trypanosoma brucei is the protozoon that causes the fatal
human sleeping sickness, as well as Nagana, a devastating...
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
... were analyzed and
quantified on a Fuji Bio-Imaging analyzer BAS-2500 using
IMAGE GAUGE
V3.3 software.
Chromatin and protein–DNA analysis
Micrococcal nuclease (MNase) digestion and in situ cleavage
by ... TSA was added, at the same time, to a
pool of injected oocytes, these are referred to as late TSA
(L). Transcription was allowed to continue for 6 h. Oocytes
were harvested and total...
Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx
... corpus
Ryo Nagata
Konan University
8-9-1 Okamoto,
Kobe 658-0072 Japan
rnagata @ konan-u.ac.jp.
Edward Whittaker Vera Sheinman
The Japan Institute for
Educational Measurement Inc.
3-2-4 Kita-Aoyama, Tokyo, ... North
American Chapter of the ACL, pages 154–162.
Joel Tetreault, Elena Filatova, and Martin Chodorow.
201 0a. Rethinking grammatical error annotation and
evaluation with the Amazon Mech...