Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx

... ABSTRACT In natural language processing, ambiguity res- olution is a central issue, and can be regarded as a preference assignment problem. In this paper, a Generalized Probabilistic Semantic ... general, a particular semantic interpretation of a sentence can be characterized by a set of lexical categories (or parts of speech), a syntactic struc- ture, and the...

Ngày tải lên: 20/02/2014, 21:20

... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and...

Ngày tải lên: 18/02/2014, 14:20

... integrate a language -model- based classifier approach with a Markov- transition model to exploit three kinds of in- formation (i.e., contextual, response, and friendship information) for sentiment ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Co...

Ngày tải lên: 20/02/2014, 05:20

... Dirichlet Form MacKay and Peto (1995) show that based on Dirich- let priors a reasonable form for a smoothed distribu- tion can be expressed as α(c|ab) = C(abc) C(ab∗) + A (8) γ(ab) = A C(ab∗) + A The ... rea- sonable alternative is to take A to be proportional to the missing count due to low-count n-grams: C(ab) − C(ab∗). A( ab) = max(1, K(C(ab) − C(ab∗))) A different K cons...

Ngày tải lên: 20/02/2014, 09:20

... though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic overtones, which render the choice of a marker meaning- driven, as ... found a cheap bar. If one accepts these sentences as paraphrases, then the various discourse markers all need to be associated with the information that they sig- nal a concessiv...

Ngày tải lên: 20/02/2014, 18:20

... can be used to design a shallow semantic representation that can be matched against other semantically similar sentences, e.g. [ ARG0 Researchers] [ r el describe] [ ARG1 antigens] [ ARG2 as foreign ... suggest that syntactic information helps tasks such as question/answer classifi- cation and that shallow semantics gives re- markable contribution when a reliable set of PASs can be extra...

Ngày tải lên: 20/02/2014, 12:20

... say, alphabetically. 6 Aspectual Feature Determination for Composed LCS's Modifications described above reveal similarities be- tween verbs that carry a lexical aspect, feature as part ... sentential levels. Finally, we illustrate how access to lexical aspect facilitates lexical selection and the interpretation of events in machine transla- tion and foreign language tutoring a...

Ngày tải lên: 22/02/2014, 03:20

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases (...

Ngày tải lên: 15/02/2014, 01:20

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolve...

Ngày tải lên: 16/02/2014, 09:20

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis ... 40760–40767. 34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S (1999) TRAIL causes cleavage of bid by caspase-8 and loss of mitochondrial membrane potential resulting in apoptosis in BJAB...

Ngày tải lên: 19/02/2014, 06:20