Tài liệu Báo cáo khoa học: "Know When to Hold''''''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf
Tài liệu Báo cáo khoa học: "Know When to Hold''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf
... appropriate parsing algorithm to take advantage of the information that a semantic head provides. For example, a head usually provides information about the remaining daughters that the parser ... Know When to Hold 'Em: Shuffling Deterministically in a Parser for Nonconcatenative Grammars* Robert T. Kasper, Mike Calcagno, and Paul C. Davis Department of Linguistics, Ohio State University ... straints yields a dramatic improvement in the overall performance of a head-corner parser for German. The remainder of the paper is organized as fol- lows: §2 introduces the nonconcatenative...
- 7
- 397
- 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... remain poorly characterized. EWS belongs to a family that includes the closely related proteinstranslocated in liposarcoma and the TATA-bindingprotein-associated factor 15 which are involved in several ... annealing or quadruplex formation wasperformed by heating samples to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin–1.Name SequencessDNAS d(CATTCCCACCGGGACCACCAC)ssDNA ... CGG ATT ACA G)and EWS reverse d(CGC TCG AGT CAC TAG TAG GGCCGA TCT CTG C), for pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA...
- 11
- 786
- 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf
... An anthrax lethal factor mutant that is defective atcausing pyroptosis retains proapoptotic activityStephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy MogridgeDepartment of Laboratory ... cleavingthese mitogen-activated protein kinase kinases is to interfere with extracellu-lar signal-related kinase (ERK), p38 and c-Jun N-terminal kinase signaling.Here, we characterized an ... defective at cleaving a substrateinvolved in the activation of the Nlrp1b in ammasome.AbbreviationsERK, extracellular signal-related kinase; HA, hemagglutinin; IL, interleukin; JNK, c-Jun N-terminal...
- 9
- 579
- 0
Tài liệu Báo cáo khoa học: Hepatic stimulator substance mitigates hepatic cell injury through suppression of the mitochondrial permeability transition pdf
... path-ways are the extrinsic and intrinsic pathways. In theintrinsic pathway (also known as the ‘mitochondrialpathway’), apoptosis results from an intracellular cas-cade of events in which mitochondrial ... CCCP-induced apoptosisCaspase activation is a key step in DNA damage-induced apoptosis. To further understand the protec-tive effect of HSS against CCCP-induced apoptosis,the activation of caspase-3 ... caspase-3 was examined using theenzymatic Caspase-Glo 3 ⁄ 7 assay. After CCCP treat-ment, caspase-3 activity increased markedly in vector-transfected cells, and this increase was inhibited in HSS-expressing...
- 13
- 565
- 0
Tài liệu Báo cáo khoa học: Animal models of amyloid-b-related pathologies in Alzheimer’s disease docx
... tests are also time-consuming and greatly in uenced by individual handlers. IntelliCages areautomated learning cages where animals carryingtransponders are housed in groups and trained in learning ... JC,Paul SM & Holtzman DM (2001) Peripheral anti -A beta antibody alters CNS and plasma A beta clearanceand decreases brain A beta burden in a mouse modelof Alzheimer’s disease. Proc Natl Acad ... b- and c-secretase canbe tested in nontransgenic animals. Pharmacologicalstudies with the c-secretase inhibitor semagacestat(LY450139) showed that temporal changes in plasmaand CSF Ab in patients,...
- 21
- 559
- 0
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf
... presence of a two-fold axis, all of the inter-actions reported below are repeated twice; that is, if Ala25 ofchain A is close to Asn77 of chain B, then Asn77 of chain A isclose to Ala25 of chain B.Chain ... diffracts to a Table 1. Statistics on data collection and refinement. A wavelength of 0.8726 A ˚was used. Rotations of 1° were performed. The Ramachan-dran plot was calculated usingRAMPAGE.X-ray ... chain B.Chain A Chain B Hydrogen bondsAla25 Asn77, Arg80 AlaO–ArgNH1AlaO–ArgND2Asn26 His35, Arg80, Asn39 AsnOD1–ArgNH1AsnOD1–HisNE2Ser28 Arg76Trp30 Arg42, Trp30, Arg76His35 Glu178, Asn26 HisNE2–AsnOD1Phe36...
- 10
- 768
- 0
Tài liệu Báo cáo khoa học: Plasticity of laccase generated by homeologous recombination in yeast docx
... report, a similar approach allowedauthors to isolate a variant of a M. thermophila laccasecapable of resisting a wide array of co-solvents at con-centrations as high as 50% v ⁄ v [14]. In all availableexamples ... domain (BCBD)protein family, we aim to evolve laccases into artificialcatalysts performing new activities. In a first approach,basic protein engineering techniques – such as fusionof laccase ... fungal laccases.Replacement of the aspartic acid D206 by alanine in a Trametes versicolor laccase resulted in a threefoldincrease in kcat[10]. A similar improvement factor wasalso reported for...
- 10
- 585
- 0
Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efficacy pdf
... TRBP and Dicerbinding and silencing efficacyHemant K. Kini and S. P. WaltonApplied Biomolecular Engineering Laboratory ⁄ Cellular and Biomolecular Laboratory, Department of Chemical Engineering ... EGFP-targeting siRNAs and either a non- targeting (NT) siRNA (white bars), a TRBP-targeting siRNA (A, gray bars) or Dicer-targeting siRNA (B, black bars). Total final siRNA concentrations were ... R2D2binding rather than actively participating in determiningwhich end to bind [18]. Future work examining internaland terminal modifications will identify design rules for enhancing the activity...
- 10
- 700
- 0
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx
... parameters of each leaflet separately,including the whole acyl chain and the ‘plateau region’described above. Taking the approach applied byBachar and Becker [18], we analyzed the lipids in ... the leaflet with which it interactsmost closely (i.e. the extracellular face), at the sametime as increasing lipid order in the cytofacial leaflet.Simulations of melittin in DPPC lead to an interest-ing ... basic interactions between Ab and a model mem-brane can lead to a more complete understanding ofthe membrane-aided assembly of Ab and the resultingdamage to cell membranes.J. A. Lemkul and...
- 16
- 475
- 0
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt
... the antisense primer5¢-AAG AATTCT AGA TTA ATG GTG ATG ATG GTGATG ATG GTG TGG GGT CAG CGG TGC AGC AGGGGG GGT-3¢ (XbaI sites underlined; His-tag in italic) andpVL1393–HSL [18] as template was ... andnonphosphorylated HSLAs a first attempt to investigate whether the increase in hydrophobic surface area is reflected by increasedbinding of phosphorylated HSL to lipid surfaces, weinvestigated the interaction ... radiolabelled ATP, with total ATPconcentrations in the phosphorylation reaction of 15 lM or 200 lM,and analysed for incorporation of32P (A) and activity against the TO substrate (B). The results in...
- 11
- 562
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfbao cao khoa hoc ve yeu to anh huong den muc do hai long voi nguoi nop thueknow when to hold emtài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị10 trần thị luyến và cộng sự hoàn thiện quy trình sản xuất chitin chitosan và chế biến một số sản phẩm công nghiệp từ phế liệu vỏ tôm cua báo cáo khoa học đề tài cấp bộ nha trang 2000nghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ