Tài liệu Báo cáo khoa học: "Word Order in German: A Formal Dependency Grammar Using a Topological Hierarchy" pptx

Tài liệu Báo cáo khoa học: "Word Order in German: A Formal Dependency Grammar Using a Topological Hierarchy" pptx

Tài liệu Báo cáo khoa học: "Word Order in German: A Formal Dependency Grammar Using a Topological Hierarchy" pptx

... field can be occu- pied by a non-verbal phrase or by a verb cre- ating an embedded domain. 3 Formalization A grammar in the formalism we introduce in the following will be called a Topological Dependency ... mathemati- cal formalism, in the usual terminology of traditional German grammars. In Section 3, a mathematical formalism is proposed to state the rules and the g...

Ngày tải lên: 20/02/2014, 18:20

8 575 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 10482 10661 179 1G4P217 Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 81.8 ± 5.03 79.0 ± 1.83 Table 4. Comparison of...

Ngày tải lên: 14/02/2014, 19:20

12 796 0
Tài liệu Báo cáo khoa học: Proteasome involvement in the degradation of the Gq family of Ga subunits pptx

Tài liệu Báo cáo khoa học: Proteasome involvement in the degradation of the Gq family of Ga subunits pptx

... Regulated ubiquitination of proteins in GPCR-initiated signaling pathways. Trends Pharmacol Sci 25, 35–41. 13 Berman DM & Gilman AG (1998) Mammalian RGS proteins: barbarians at the gate. ... muscarinic recep- tor 1 (M1R) and Ga q , showed the characteristic increase in accumulation of inositol phosphates. Lig- and-induced release of inositol phosphates was again markedly increased aft...

Ngày tải lên: 20/02/2014, 03:20

13 465 0
Tài liệu Báo cáo khoa học: "Refined Lexicon Models for Statistical Machine Translation using a Maximum Entropy Approach" pptx

Tài liệu Báo cáo khoa học: "Refined Lexicon Models for Statistical Machine Translation using a Maximum Entropy Approach" pptx

... Statistical Machine Translation using a Maximum Entropy Approach Ismael Garc ´ a Varea Dpto. de Inform´atica Univ. de Castilla-La Mancha Campus Universitario s/n 02071 Albacete, Spain ivarea@info-ab.uclm.es Franz ... Computational Linguistics and 17th Int. Conf. on Computational Linguistics, pages 960–967, Montreal, Canada, August. Franz J. Och and Hermann Ney. 200 0a. Giza++: Training...

Ngày tải lên: 20/02/2014, 18:20

8 427 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... N-terminal hexahistidine tag was obtained by PCR using the pET2 1a ⁄ PNT- H6 plasmid [30] as the template. The forward primer (5¢-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3¢) was designed to insert a ClaI ... N-terminus was obtained by PCR from the plasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3¢) designed to introduce a...

Ngày tải lên: 18/02/2014, 04:20

14 673 0
Tài liệu Báo cáo khoa học: "Word representations: A simple and general method for semi-supervised learning" doc

Tài liệu Báo cáo khoa học: "Word representations: A simple and general method for semi-supervised learning" doc

... documents). We also evaluated on an out-of-domain (OOD) dataset, the MUC7 formal run (59K words). MUC7 has a different annotation standard than the CoNLL03 data. It has several NE types that don’t appear in ... would combine the dev and training set and training a model over this combined set, and then evaluate on test.) The standard evaluation benchmark for NER is the CoNLL03 shared t...

Ngày tải lên: 20/02/2014, 04:20

11 688 0
Tài liệu Báo cáo khoa học: "Word Alignment with Synonym Regularization" doc

Tài liệu Báo cáo khoa học: "Word Alignment with Synonym Regularization" doc

... Shindo, Akinori Fujino, and Masaaki Nagata NTT Communication Science Laboratories, NTT Corp. 2-4 Hikaridai Seika-cho Soraku-gun Kyoto 619-0237 Japan {shindo ,a. fujino}@cslab.kecl.ntt.co.jp nagata.masaaki@lab.ntt.co.jp Abstract We ... remaining sentence pairs as evaluation data. We also ran- domly selected 10k, 50k, and 100k sized sentence pairs from the corpus as additional training data. We...

Ngày tải lên: 20/02/2014, 04:20

5 471 2
Tài liệu Báo cáo khoa học: "Word to Sentence Level Emotion Tagging for Bengali Blogs" doc

Tài liệu Báo cáo khoa học: "Word to Sentence Level Emotion Tagging for Bengali Blogs" doc

... for training as well as for the classification of each word of a sentence into the above-mentioned six emotion tags and one neutral tag. By manually reviewing the Bengali blog data and different ... learning techniques on blog data for comparative evaluation. Importance of verbs and adjectives in identifying emotion has been explained in (Chesley et al., 2006). (Yang et al., 200...

Ngày tải lên: 20/02/2014, 09:20

4 429 0
Tài liệu Báo cáo khoa học: "Word Vectors and Two Kinds of Similarity" pptx

Tài liệu Báo cáo khoa học: "Word Vectors and Two Kinds of Similarity" pptx

... diagonal matrix Σ consists of r singular val- ues that are arranged in nonincreasing order such that r is the rank of M . When we use a k × k ma- trix Σ k consisting of the largest k singular ... relation. This dichotomy of similarity is practically im- portant. Some tasks such as automatic thesaurus updating and paraphrasing need assessing taxo- nomic similarity, while some other tasks...

Ngày tải lên: 20/02/2014, 12:20

8 473 0
Tài liệu Báo cáo khoa học: "Word Alignment for Languages with Scarce Resources Using Bilingual Corpora of Other Language Pairs" pptx

Tài liệu Báo cáo khoa học: "Word Alignment for Languages with Scarce Resources Using Bilingual Corpora of Other Language Pairs" pptx

... bilingual data are available for the desired language pair L1-L2, large-scale bilin- gual corpora in L1-L3 and L2-L3 are available. Using these two additional bilingual corpora, we train two ... to adapt to any language pair where a pivot lan- guage and corresponding large-scale bilingual corpora are available. 3 Statistical Word Alignment According to the IBM models (Brown et al....

Ngày tải lên: 20/02/2014, 12:20

8 359 0
Từ khóa:
w