Tài liệu Báo cáo khoa học: "Lexical transfer using a vector-space model" doc

... Lexical transfer using a vector-space model Eiichiro SUMITA ATR Spoken Language Translation Research Laboratories 2-2 Hikaridai, Seika, Soraku Kyoto 619-0288, Japan sumita@slt.atr.co.jp ... from case-frame representations of simple sentences with a thesaurus for generalization (Akiba et. al., 1996 and Tanaka, 1995); (2) approaches using structural matching: to obtain...

Ngày tải lên: 20/02/2014, 18:20

... word 'bank' has been chosen, then only the 'economic' or 'neutral' senses of the 'arrange', 'overdraft' and 'ac- count' will be taken ... for lexical disambiguation, par- ticularly [Guthrie et al., 1992]'s and [Lesk, 1986]'s, as there is no standard evaluation benchmark; but this approach seems to work reasonably well...

Ngày tải lên: 22/02/2014, 10:20

... a partic- ular template. The present template was ClaC2aCaa, the past template aCtC2aaC3, and the future template aClaC2Caa. Thus the three forms for the root pmn were pamana, apmaan, ... rules, involving three forms: (1) present: CzaC2aCaa, past: aCiC2aaC3, future: aClaC2C 3a (2) present: ClaC2Caaa, past: aC1C2aCaa, future: aClaC3aC2. 282 PC 2 ,,,,i,,, 2 -0.4 -0....

Ngày tải lên: 20/02/2014, 21:20

... Journal 272 (2005) 2869–2877 ª 2005 FEBS 2875 5¢-TCAGCGTTCTCGGAATTC-3¢; AP2-Xba-R, 5¢-TTTT ACAGTAATATAAAGAATTTCGCTCTAGATCAAGGA CCTCCCGCAAGCGCGAG-3¢; and AP2-R, 5¢-TTACA GTAATATAAAGAATTTCGCTCTAGA-3¢, ... MgCl 2 using an ALS Electrochemical Analyzer 62 4A, and the potential was deter- mined by averaging the anodic and cathodic peak potentials. Presteady-state kinetic studies Presteady-state r...

Ngày tải lên: 19/02/2014, 18:20

... forward primer), 5¢-CAGGTAACCGTGCGCG ACGCAAGCTCAACCAGGTCGAAG-3¢ (H18 1A, reverse primer), 5¢-GTTGAGCTTCACTCTGCGGCGGGTTACC TGCTGCATCAG-3¢ (H184, forward primer) and 5¢-CTG ATGCAGCAGGTAACCCGCCGCAGAGTGAAGCTCA AC-3¢ ... 5¢-TTCACTCTG CGCACGGTTTTCTGCTGCATCAGTTC-3¢ (Y186F for- ward primer), 5¢-GAACTGATGCAGCAGAAAACCGTG CGCAGAGTGAA-3¢ (Y186F, reverse primer), 5¢-CTTCG ACCTGGTTGAGCTTGCGTCTGCGCACGGTTACC...

Ngày tải lên: 20/02/2014, 02:21

... convincing ways of evaluation (Jin- dal and Liu, 2006). A comparative sentence for- mulates an ordering relation between two entities and that relation is very useful for many applica- tion areas. One ... Korean as an agglutinative lan- guage and that of English as an inflecting lan- guage have seriously different aspects. One of the greatest differences related to our work is that there...

Ngày tải lên: 20/02/2014, 09:20

... mechanisms and data structures, rather than an adjunct to other computational processes. Investigations of machine-readable dictionaries over the last decade have shown that they can be computationally ... from the task of building natural language processing programs that will use that knowledge base. Several of the components of a lexical knowledge base are already known and await...

Ngày tải lên: 21/02/2014, 20:20

... diction- ary (Garzanti IT-FR (2006)) shows that more than 1 000 Italian relational adjectives have no equivalent in French (and are generally translated with a prepositional phrase). 131 All these ... interuniversi- taria. From a contrastive point of view, the pre- fixation of relational adjectives exists in both languages (Italian and French) and in both these languages prefixing...

Ngày tải lên: 22/02/2014, 02:20

... negotiation usually arrives at a satisfactory conclusion. The user can also choose to backtrack at any time. In any case, although grammaticality judgments are sometimes variable and indeterminate, ... are no minimal sets, because every set of paradigms that together al- lows the sentences the user has said are grammatical also allows a sentence that was (by implication) judged...

Ngày tải lên: 22/02/2014, 10:20

... an interaction partner for ADAM10 that enhances a- sec- retase shedding of APP, probably by regulating matu- ration of the prodomain of ADAM10 [22]. The catalytical domain of ADAM10 contains a typical zinc-binding ... 102, 1595–1605. 106 Arduise C, Abache T, Li L, Billard M, Chabanon A, Ludwig A, Mauduit P, Boucheix C, Rubinstein E & Le NF (2008) Tetraspanins regulate ADAM10-medi- a...

Ngày tải lên: 16/02/2014, 09:20