Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

... be false. Actions have a number of param- eters, as well as a precondition and effect, both of which are logical formulas. When a planner tries to apply an action, it will first create an action ... the past decade, and by encoding sentence generation as a planning problem, we are set to profit from any future improvements; it is an advantage of the planning approach that we...

Ngày tải lên: 20/02/2014, 12:20

... The woman wanted the dresm on that rock. has low attachment of the PP, whereas The tnoman positioned the dreu on that rack. has high attachment. Garden-Path Sentences Grammatical sentences ... general rules for disam- biguating sentences can yield appropriate behavior for a large class of performance phenomena right a- ~soeiation, minimal at- tachment, lexical preference, and gard...

Ngày tải lên: 21/02/2014, 20:20

... to lm) and stabilize just one protein and thus are gener- ally protein and disease selective, if not specific. Many of the clinically important Fabry disease-asso- ciated a- galactosidase A variants ... S, Asano N & Suzuki Y (1999) Acceler- ated transport and maturation of lysosomal alpha-galac- tosidase A in Fabry lymphoblasts by an enzyme inhibitor. Nat Med 5, 112–115. 20 Fan J-Q &a...

Ngày tải lên: 18/02/2014, 16:20

... stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations ... the association of the variable heavy chain (V H )with protein A was used as a surrogate for direct stability measurements. The V H domains in camelid heavy chain antibodies are mos...

Ngày tải lên: 19/02/2014, 12:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting ... (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTA...

Ngày tải lên: 19/02/2014, 17:20

... with a window of five wavenumbers, assuming that adjacent wavenumbers are highly corr elated. A population o f 3 2 solutions was built at each generation, and e valuated. The algorithm stopped a ... greatest interclass variance and the smallest intraclass variance, and constructs a linear combination of the variables to discriminate between the classes. The rule i s constructed with t...

Ngày tải lên: 21/02/2014, 03:20

... not view a subtype link as an arbitrary implication such as (1.1) and it does not view a type link as an arbitrary atomic sentence such as (1.2). In our representation language we capture the ... (individuals and types), and two axioms ( (A. 1) and (A. 2)). We shall name types in uppercase and individuals in uppercase letters followed by at least one digit. Considering the...

Ngày tải lên: 21/02/2014, 20:20

... plural noun 'boys' /wulid-/ 1st measure, past passive verb 'was born' /wallad-/ 2nd measure, past active verb 'generated' /wullid-/ 2nd measure, past passive ... to a proper name. ALMDYR +HSN may be translated 'principal Hasan', ALMDYR QASM 'director Qasim', and ALMDYR ABRAHYM 'coffee-boy Ibrahim'. Knowledge of the actu...

Ngày tải lên: 19/02/2014, 19:20

... results. 4.1 Evaluation setting The task on which we conduct our evaluation is information ordering (Lapata, 2003; Barzilay and Lee, 2004; Barzilay and Lapata, 2005). In this task, a pre-selected ... needs a search algorithm that is able to produce ranked -best lists of the most promis- ing candidates in a reasonably fast manner (Huang and Chiang, 2005). We accommodate -best computation...

Ngày tải lên: 20/02/2014, 12:20

... information is stored in a variation of Augmented Transition Networks (ATNs) called Dialogue Action Forms (DAFs). These DAFs represent general dialogue moves, as well as sub-tasks or topics, and are ... COMIC we have placed greater emphasis on producing high- quality adaptive output than have previous embodied dialogue projects such as August (Gustafson et al., 1999) and Rea (Cassell...

Ngày tải lên: 20/02/2014, 15:20