... against the various subunits of the yeast cyto- chrome bc 1 complex. Another antibody used was that against Bcs1p (a generous gift from R. Stuart, Marquette University, Milwaukee, WI, USA). The ... were used for the preparation and ligation of DNA fragments, for the trans- formation of Escherichia coli and for the isolation of plas- mid DNA from bacterial cells [51]...
Ngày tải lên: 18/02/2014, 08:20
... lizards and frogs (lacking both essential aspar- tates at the b4- and b7-strands) and also from some fishes (lacking the b4-strand aspartate). This may mean that the eventuality of a- glucosidase ... human rBAT; and (d) conserving the catalytic resi- dues (often the entire catalytic triad). Some of these features can be traced in the sequences of hcHAT1 and hcHAT2 groups as...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt
... plot of the data from (A) in the range 0–100 m M Ca 2+ . (C) Modified Scatchard plot of the data from (B). DA corresponds to the change in relative activity. The PLDa2 activity was measured against ... illustrates the quality of the experimental data (Fig. 2B). Reconstruction of the overall shape of the PLDa2 from the X-ray scattering data was achieved by the...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... FEBS naya OA, Kolpakov FA et al. (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26, 362–367. 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara ... 1162–1168. 13 Nakayama M, Takahashi K, Kitamuro T, Yasumoto K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba- hara S (2000) Repression of heme oxygenase-1 by hypoxia in vascular endothelia...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx
... fully active state. In contrast, the arginase activity of the Asn149Asp variant was practically undetectable, both before and after the incubation with the manganese ions. Fully active His120Asn and ... Asn149 and the a- carboxylate group of arginine were also operative for arginase II, both the lack of arginase activity as well as the resistance of the Asn149Asp muta...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo khoa học: Mapping the functional domains of human transcobalamin using monoclonal antibodies pptx
... maximal mAb ⁄ heparin effect on the functional activ- ity of TC. Arrows show the hypothetical movement of the domains after attachment of Cbl, see the main text. Mapping of transcobalamin using antibodies ... Geremia S & Randaccio L (2001) Crystallization and preliminary X-ray diffraction analysis of human transcobalamin, a vitamin B 12 -transporting protein. Acta Cr...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx
... Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents Julie S. Bødker, Troels Wind, Jan K. Jensen, Martin Hansen, Katrine ... to a monoclonal antibody against PAI-1, Mab-2 (Table 1). Mab-2 has an epitope of residues in hF and its flanking sequences [37]. Mab-1 protection of PAI-1 aga...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: Mapping the functional domain of the prion protein docx
... Oligonucleotide PrP23–112 GCATGTGGCAGGGCTCGAGGCAGCTGGGGC PrP23–171 GCAACCAGCTCGAGTTCGTGCACG PrP45–231 GGGAAGCCATATGGGCAACCG PrP90–231 GCCCCATGGCGGTGGATGGCATATGGGAGG GGGTACCC PrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACC TCAAGC PrP113–231 ... GGAACAAGCCCAGCCATATGAAAACCAACC TCAAGC PrP113–231 CCAACCTCAAGCATATGGCAGGG PrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCC PrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCC PrPD11...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx
... then washed, and the amount of bound antibody against LDLR was measured by subsequent binding of 125 I-labeled goat anti-(rabbit IgG) (10 lgÆmL )1 ). A control in which the anti- body against ... surface. Data analysis All binding and kinetic data were fitted by nonlinear regres- sion with prism 5 (GraphPad Software, CA, USA). For inhibition-binding curves, the raw data were...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... USA Introduction Upon catalyzing the cleavage of RNA, RNases operate at the crossroads of transcription and translation. Bovine pancreatic RNase A (EC 3.1.27.5) is the best characterized RNase. A notoriously stable ... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Structural data for the two RNase A c...
Ngày tải lên: 14/02/2014, 22:20