Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf

Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf

Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf

... representation of the interpretation of logical metonymy and a more thorough evaluation method than that of Lapata and Lascarides (2003). By carrying out a human experiment we prove that such a representation ... by Lapata and Lascarides (2003) used text corpora to automatically derive interpretations of metonymic phrases. 1 Utiyama et al. (2000) used a statistical mod...

Ngày tải lên: 20/02/2014, 09:20

9 429 0
Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

... (5¢fi3¢) Corresponding peptide AS1 GGTTGCCTGAGRTGYATHTG a GCLRCIC AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL AS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATL AS4R GATCTGATACGGTCCACACGACAG LSCGPYQI a H ¼ A or C or T; R ¼ AorG;Y¼ ... 12 0A PTH analyser. Synthesis of cDNA Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. It was treated with RNAa...

Ngày tải lên: 19/02/2014, 12:20

6 738 0
Tài liệu Báo cáo khoa học: "Robust Conversion of CCG Derivations to Phrase Structure Trees" pdf

Tài liệu Báo cáo khoa học: "Robust Conversion of CCG Derivations to Phrase Structure Trees" pdf

... 1). 2.2 Clark and Curran (2009) Clark and Curran (2009), hereafter C&C-CONV, as- sign a schema to each leaf (lexical category) and rule (pair of combining categories) in the CCG derivation. The ... parameters. Our approach leads to in- creases on all metrics of at least 1.1%, and increases exact sentence match by over 11% (both absolute). Many of the remaining errors relate to mis...

Ngày tải lên: 19/02/2014, 19:20

5 492 0
Tài liệu Báo cáo khoa học: "Semantic Classification of Noun Phrases Using Web Counts and Learning Algorithms" ppt

Tài liệu Báo cáo khoa học: "Semantic Classification of Noun Phrases Using Web Counts and Learning Algorithms" ppt

... effective algorithm for the classification task. Turney and Littman (2005) achieve an accuracy of 45.7%, where we achieve a maximum accuracy of 38.1% on this dataset using a nearest neighbor algorithm. ... this is that dividing a set of 600 in- stances into 30 classes results in a fairly sparse and uneven dataset. Table 1 is a list of the relations used and examples...

Ngày tải lên: 20/02/2014, 12:20

6 623 2
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

... Dynamic model-theoretic semantics allows the evaluation of a formula to cause the addition of information to the model. This interaction of the evaluation of a formula and the expansion of ... semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually...

Ngày tải lên: 21/02/2014, 20:20

3 394 0
Tài liệu Báo cáo khoa học: "The Structure of User-Adviser Dialogues: Is there Method in their Madness?" pdf

Tài liệu Báo cáo khoa học: "The Structure of User-Adviser Dialogues: Is there Method in their Madness?" pdf

... ABSTRACT FOCUSING AND ANAPHORA RESOLUTION Novice users engaged in task-oriented dialogues with an adviser to learn how to use an unfamiliar statistical package. The users', task was ... and an analysis of the users' and adviser's plans and goals. BOUNDARY MARKERS The analysis of boundary markers revealed reliable indicators at the opening of subdialogues in adv...

Ngày tải lên: 21/02/2014, 20:20

7 400 0
Tài liệu Báo cáo khoa học: "Some Uses of Higher-Order Logic in Computational Linguistics" pdf

Tài liệu Báo cáo khoa học: "Some Uses of Higher-Order Logic in Computational Linguistics" pdf

... H(Ax P) and 3x P is an abbreviation for G(Ax P). H and E are examples of what are often called generalized quantifiers. The type o has a special role in this language. A for- mula with a ... such analyses in one computational framework. A common approach in natural language understanding systems is to use one computational paradigm for syntactic analysis (e.g. DCGs, ATNs) a...

Ngày tải lên: 21/02/2014, 20:20

10 504 0
Tài liệu Báo cáo khoa học: "The Role Of Focussing in Interpretation of Pronouns " pdf

Tài liệu Báo cáo khoa học: "The Role Of Focussing in Interpretation of Pronouns " pdf

... concept of antecedence is defined computationally as a relationship among elements represented in a database. Using this framework, the paper supports two claims by means of rules for antecedence. ... inference. The paper also indicates what additional requirements are needed for a full treatment of pronominal anphora. These include use of a representation such as that...

Ngày tải lên: 21/02/2014, 20:20

2 514 0
Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc

Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc

... lyase pathway). Bottom: cleavage to yield AMPA and glyoxylate (the AMPA pathway), referred to as the GOX pathway. (B) Reaction catalyzed by GO on glyphosate, an alternative to the AMPA pathway ... glyphosate cannot be regarded a mere analog of PEP, but it rather appears to mimic an intermediate state of PEP, pre- sumably that of the elusive carbocation. More than 1000 analogs of gly...

Ngày tải lên: 14/02/2014, 14:20

14 795 0
Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

... Pervandate and catalase were prepared as described previously [25]. Briefly, vanadate stock solution was prepared as a 200 m M solution of sodium orthovanadate (pH 10). Pervanadate was prepared as ... blotting of lysates from pervanadate-treated cells with an antibody against total tau revealed decreased electrophoretic mobility of tau, with the appearance of an  68-kDa tau species...

Ngày tải lên: 14/02/2014, 14:20

11 629 0
w