Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... 2011. c 2011 Association for Computational Linguistics MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages Cheng-Te Li 1 Chien-Yuan Wang 2 Chien-Lin ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual...

Ngày tải lên: 20/02/2014, 05:20

... excess of information. FAQ-pages tend to also answer questions which are not asked, and also con- tain practical examples. Human-powered answers often contain unrelated information and discourse- like ... Takaaki Hori, and Sadaoki Furui. 2003. Evaluation Methods for Automatic Speech Summa- rization. In In Proc. EUROSPEECH, volume 4, pages 2825–2828, Geneva, Switzerland. Valentin Jijko...

Ngày tải lên: 20/02/2014, 09:20

... syntac- tic, semantic, and lexical rules are applied by a bottom-up all-paths constituent parser to populate a chart with edges containing syntactic, seman- tic, and logical form information. ... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that makes...

Ngày tải lên: 20/02/2014, 21:20

... to domain knowledge already encoded in the knowledge base of a limited domain natural language application such as a database query system. Given a hand-coded hierarchical organization of ... critiquing system& apos;, IBM Systems Journal, vol.21, 305- 326 Kaplan, R. and Bresnan, J.(1982) 'Lexical-Functional Grammar: A Formal System for Grammatical Representation...

Ngày tải lên: 22/02/2014, 09:20

... id='1' start='158' end='176' features='participant;human' state='active'/> <segment id='2' start='207' end='214' ... developed to facilitate the human annotation of text. These have been necessary where software for automatic annotation has not been available, e.g., for linguistic patterns which a...

Ngày tải lên: 20/02/2014, 09:20

... parse features are generated using the Char- niak parser (Charniak, 2000) trained on the standard Wall Street Journal Treebank corpus. We chose to use this standard data set as we do not have any domain-specific ... also use a standard statistical parser (Charniak, 2000) to provide syntactic analysis. In practice, a teacher is likely to be looking for texts at a particular level rather...

Ngày tải lên: 20/02/2014, 15:20

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Technology, Nagatsuta, Midori-ku, Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type...

Ngày tải lên: 15/02/2014, 01:20

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolve...

Ngày tải lên: 16/02/2014, 09:20

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads...

Ngày tải lên: 18/02/2014, 14:20

... coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa Biswas Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, Kolkata, ... S, Sundd M, Jagan- nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C, two thiol proteases from Ervatamia coronaria. Acta Crystallogr...

Ngày tải lên: 18/02/2014, 16:20