Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf
... 2011. c 2011 Association for Computational Linguistics MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages Cheng-Te Li 1 Chien-Yuan Wang 2 Chien-Lin ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual...
Ngày tải lên: 20/02/2014, 05:20
... excess of information. FAQ-pages tend to also answer questions which are not asked, and also con- tain practical examples. Human-powered answers often contain unrelated information and discourse- like ... Takaaki Hori, and Sadaoki Furui. 2003. Evaluation Methods for Automatic Speech Summa- rization. In In Proc. EUROSPEECH, volume 4, pages 2825–2828, Geneva, Switzerland. Valentin Jijko...
Ngày tải lên: 20/02/2014, 09:20
... syntac- tic, semantic, and lexical rules are applied by a bottom-up all-paths constituent parser to populate a chart with edges containing syntactic, seman- tic, and logical form information. ... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that makes...
Ngày tải lên: 20/02/2014, 21:20
Tài liệu Báo cáo khoa học: "TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REAL TIME PARSING" potx
... to domain knowledge already encoded in the knowledge base of a limited domain natural language application such as a database query system. Given a hand-coded hierarchical organization of ... critiquing system& apos;, IBM Systems Journal, vol.21, 305- 326 Kaplan, R. and Bresnan, J.(1982) 'Lexical-Functional Grammar: A Formal System for Grammatical Representation...
Ngày tải lên: 22/02/2014, 09:20
Tài liệu Báo cáo khoa học: "Demonstration of the UAM CorpusTool for text and image annotation" docx
... id='1' start='158' end='176' features='participant;human' state='active'/> <segment id='2' start='207' end='214' ... developed to facilitate the human annotation of text. These have been necessary where software for automatic annotation has not been available, e.g., for linguistic patterns which a...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu Báo cáo khoa học: "Reading Level Assessment Using Support Vector Machines and Statistical Language Models" pdf
... parse features are generated using the Char- niak parser (Charniak, 2000) trained on the standard Wall Street Journal Treebank corpus. We chose to use this standard data set as we do not have any domain-specific ... also use a standard statistical parser (Charniak, 2000) to provide syntactic analysis. In practice, a teacher is likely to be looking for texts at a particular level rather...
Ngày tải lên: 20/02/2014, 15:20
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Technology, Nagatsuta, Midori-ku, Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolve...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
... coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa Biswas Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, Kolkata, ... S, Sundd M, Jagan- nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C, two thiol proteases from Ervatamia coronaria. Acta Crystallogr...
Ngày tải lên: 18/02/2014, 16:20