0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx

... Computational LinguisticsSemantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue SystemWei-Bin Liang1Chung-Hsien Wu2Department of Computer Science and Information ... (5) In Sections 3 and 4, we specify and explain how thescores in (5) are computed.Figure 2: An example of a dialogue management mod-ule using n-gram model for dialogue act sequence in thedomain ... utterance, Htis the dialogue historical information, and Ω = {A 1, . . . , A q} is theset of DAs. Using the maximum approximation for summation, (1) can be written as A ∗t= arg max A ΩWP...
  • 6
  • 555
  • 0
Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx

Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx

... grey) and the C-ter-minal activation of hMS (grid-barrel) interact with the cobalamin-binding domain. For more information on hMS conformational substates,see [5] and [33].K. R. Wolthers and ... radioactivity in the flowthrough and wash fractions was quantitated by scintillation counting. For MSR-catalysed assays (used for measuring the KmofNADPH and the K act of MSR), AqCbl and dithiothreitolwere ... centre, and ultimately to an acceptor redox pro-tein or domain. Although the bacterial FNR ⁄ Fld and mammalian MSR are not interchangeable in reactivat-ing MetH and hMS, respectively [14], human...
  • 10
  • 698
  • 0
Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

... stabilized in RNAlater(Ambion, Austin, TX, USA) upon dissection. RNA wasextracted and poly (A) -rich RNA was isolated as above.From this, 490 lg total RNA and 4.7 lg poly (A) -richRNA were obtained. ... Hngtrap1, ATGAACCGAGTGAACTCCATCCAC; Hngtrap2, ACTTCTTCCGCTGGAACAGCCACA. The resultant clones were sequenced in- house, using the CEQ2000 system (Beckman Coulter,Fullerton, CA, USA).All use of animals ... use of animals complied with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the Intramural Animal Care and Use program of theNational Institutes of Health (NIH).G....
  • 16
  • 561
  • 0
Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc

Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc

... protein activates the ras/mitogen-activated protein kinase pathway and (b)phosphatidylinositol 3-kinase activates the protein kin-ase B/glycogen synthase kinase-3 cascade. Recent datasuggest ... 1922–1929.11. Bandyopadhyay, G., Standaert, M.L., Zhao, L., Yu B., Avignon, A. , Galloway, L., Karnam, P., Moscat, J. & Farese, R.V. (1997)Activation of protein kinase C (a, b,andf)byinsulinin3T3/L1cells. ... insulinaction [8,10,14,15]. In contrast, the available data on hepatic systems arescarce, controversial and have been obtained using primaryadult rat hepatocyte suspensions and cultures, and...
  • 12
  • 592
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Fast Decoding and Optimal Decoding for Machine Translation" doc

... program. Here we adapt a subtour eliminationstrategy used in standard TSP. We create a binary(0/1) integer variable for each pair of hotelsFast Decoding and Optimal Decoding for Machine TranslationUlrich ... a TSP instance? If so, we may takegreat advantage of previous research into efficientTSP algorithms. We may also take advantage ofexisting software packages, obtaining a sophisti-cated decoder ... Admiralty Way, Suite 1001 Stanford, CA 94305Marina del Rey, CA 90292 jahr@cs.stanford.edugermann,knight,marcu,kyamada @isi.eduAbstract A good decoding algorithm is criticalto the success of any...
  • 8
  • 440
  • 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... the N-terminal sequence of the mature protein: 5¢TATGCGTGGTCCAATGCTATGC, and FF 3A, matchingwith the C-terminal sequence of the coding region: 5¢TTACAAGGACAAATTAATTGTGCCAG. For amplificationof ... fractionscontain a contaminating band at 90 kDa that was notdetected in the silver stained SDS/PAGE gel but seems to beIgE reactive with almost all sera tested. N-Terminalsequencing analysis ... molecular mass range, presum-ably glycoproteins. We also found reactivity of some serato a 9- and a 15-kDa band. We could show that the9-kDa band in the tomato extracts reacts with a specificantibody...
  • 11
  • 533
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Combining Functionality and Object Orientedness for Natural Language Processing" ppt

... data in the sense that they have a place (called a local variable) to store information. At the same time, they are procedures in that they can manipulate data. An object can only update local ... constant of PAL. A class object for a lexical item contains linguistic knowledge in a procedural form. In other words, a class contains information as to how a corresponding lexical item is mapped ... pointed to bll the variable rrtessage a message whose label is 'ease' and whose value is 'subject '. ; a variable rrteasage holds the value of an incoming message and a...
  • 4
  • 422
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: " Semantic Ambiguity" pdf

... Semantic Ambiguity 69 Multiple listings of equivalents, taken from Callaham's Technical Dictionary, are illustrated by the following sample entries. (The figures indicate, left, the total ... equivalents, and right, the lexicographer's attempt to distinguish between groups of synonyms.) 9-3 изменение: change, alteration, variation, modifica- tion, conversion, transformation; ... passage, crossing, migration (of ions); exchange (of places), switch- ing; blending, shading (of colors) 15-6 величина: size, dimension, measure; (math.) value, magnitude, quantity, amount;...
  • 2
  • 402
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Semantic Frequency Counts" doc

... 2) 'heavy'; 'strong.' ein schwerer Stein, &apos ;a heavy stone;' ein schwerer Wein, &apos ;a strong (intoxicating) wine.' 3) 'laden.' Das Dach ist ... of each word, and the relative frequency of occurrence of each meaning in general and/ or specialized contexts. Valuable as such a count might be to scholars and educators in various domains, ... even for any two lan- guages. However, it may be argued that: 1) the need for such information is great for MT; 2) any partial listing would provide data that could immediately be useful in...
  • 3
  • 319
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Semantic Parsing with Bayesian Tree Transducers" doc

... treesor a tree and a string.The tree transducer, a formalism from automatatheory which has seen interest in machine transla-tion (Yamada and Knight, 2001; Graehl et al., 2008) and has potential applications ... of a priormakes exact inference intractable, so we use an ap-proximate method, variational Bayesian inference(Bishop, 2006), deriving an algorithm similar to that for PCFGs (Kurihara and Sato, ... 2011), and often in- Figure 1: (a) An example sentence/meaning pair, (b) a tree transformation based mapping, and (c) a tree trans-ducer that performs the mapping.volve tree transformations...
  • 9
  • 475
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcsemantic information and derivation rulesbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)