Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... Computational Linguistics Creating a manually error-tagged and shallow-parsed learner corpus Ryo Nagata Konan University 8-9-1 Okamoto, Kobe 658-0072 Japan rnagata @ konan-u.ac.jp. Edward Whittaker ... such as for gram- matical error detection. Given this back- ground, we created a novel learner corpus that was manually error-tagged and shallow- parsed. This corpus is av...

Ngày tải lên: 20/02/2014, 04:20

... trans- lations for creating a tri-lingual collocation dic- tionary, with samples of actual use in language. Using past translations as reference for the transla- tor's further work was an ... figees en francais. OPHRYS, Paris. Isabelle P., Dymetman M., Foster G., Jutras J-M., Macldovitch E., Perrault F., Ren X., and Simard M. (1993). Translation Analysis and Translation Auto- matio...

Ngày tải lên: 22/02/2014, 02:20

... acarviosine-glucose, the isoacarbose and a- , b-andc-cyclodextrins are highly active against porcine and human pancreatic a- amylase (PPA and HPA) [29±32]. The inhibitory activity of these compounds against a- amylase ... inhibitor; HSA, human salivary a- amylase; LCAI, Lachrima jobi chitinase/ a- amylase inhibitor; PAI, pigeonpea a- amylase inhibitor; PPA, por- cine pancreatic a...

Ngày tải lên: 21/02/2014, 03:20

... that animal a- amylases are released in the intestinal tract where oxygen concentration is expected to be low, whereas bacterial linkers are devoid of Cys. However, Artemia and Acanthochitona ... Results and Discussion Identification of new modular a- amylases a- Amylases are ubiquitous enzymes hydrolyzing a- 1,4- glycosidic bonds of starch and related polysaccharides, such as glycog...

Ngày tải lên: 14/02/2014, 18:20

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Technology, Nagatsuta, Midori-ku, Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type I...

Ngày tải lên: 15/02/2014, 01:20

... cellular model of Parkinson’s disease pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and ... kinase, 60S acidic ribosomal protein P2 (RPLP2), eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12, annexin A2 , annexin A5 , aldolase A, fascin 1 and peroxyredoxin 1]...

Ngày tải lên: 15/02/2014, 01:20

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolved...

Ngày tải lên: 16/02/2014, 09:20

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads...

Ngày tải lên: 18/02/2014, 14:20

... organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain Thirumaran Thanabalu 1,2 , Rajamuthiah Rajmohan 2 , Lei Meng 2 , Gang Ren 4,5 , Parimala R. ... polyclonal GFP-spe- cific antiserum was a gift from J. Kahana and P. Silver (Dana Farber Cancer Center, Boston, MA). The anti-actin mAb was MAB1501 from Chemicon International (Teme- cula...

Ngày tải lên: 18/02/2014, 16:20

... combination of IFNa and TRAIL, relative to TRAIL alone. In view of the cleavage of caspase substrates such as BID and PARP, the effect of IFNa and TRAIL on the DNA content of MCF-7 cells was also assessed, using ... Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apopt...

Ngày tải lên: 19/02/2014, 06:20