Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

... pair similarity computation since the other parts of speech (adjectives and adverbs) do not have a taxonomic representation structure. For example, the jcn similarity measure (Jiang and Conrath, ... inancial topic in bank#n#1 and stock#n#1) without further dis- cernibility. In this case, many senses will share the same latent semantics profile, as long as they are in the same t...

Ngày tải lên: 19/02/2014, 19:20

... Computational Natural Language Learn- ing: Shared Task, pages 28–34. Malvina Nissim, Shipra Dingare, Jean Carletta, and Mark Steedman. 2004. An annotation scheme for information status in dialogue. ... evaluate the rule-based approach and the learning-based approach to determining the IS subtype of each hand-annotated NP in the test set. Classification results. Table 3 shows the re...

Ngày tải lên: 22/02/2014, 03:20

... of the addi- tion was the total disappearance of specific resonances without the concomitant appearance of other signals in other parts of the spectrum. This result could be a consequence of the ... protein ratio, the resonances of Arg20, Asp22 and Asp23 disap- peared, and the resonance of Leu21 shifted. At a 2 : 1 ratio, the resonances of residues 19 and 44...

Ngày tải lên: 18/02/2014, 16:20

... and pET A3 A 4A5 – atdA2 pACYC A1 and pET A3 A 4A5 + atdA3 pACYC A1 A2 and pET A4 A5 – Control (no deletion) pACYC A1 A2 and pET A3 A 4A5 + E. L. Ang et al. Substrate specificity of aniline dioxygenase FEBS ... and A1 _SalI_R primers. The atdA2 gene was amplified using the A2 _FseI_F and A2 _AvrII_R primers. The atdA3 gene was amplified using the A3 _EcoRI_F and A3 _SalI_R...

Ngày tải lên: 19/02/2014, 02:20

... maximal mAb ⁄ heparin effect on the functional activ- ity of TC. Arrows show the hypothetical movement of the domains after attachment of Cbl, see the main text. Mapping of transcobalamin using antibodies ... Geremia S & Randaccio L (2001) Crystallization and preliminary X-ray diffraction analysis of human transcobalamin, a vitamin B 12 -transporting protein. Acta Crys...

Ngày tải lên: 20/02/2014, 01:20

... formulated a hypo- thesis that describes an integrated vision of the catalytic mechanism of both enzymes. The main points are: (a) a re-evaluation of the role of superoxide as a reductant in the catalytic ... highlights the presence of mutual chemical interactions between enzyme intermedi- ates and provides and explanation for catalase activity. Other questions, such...

Ngày tải lên: 20/02/2014, 02:21

... semi-structured data made available to search engines, such as relational databases and semantically annotated web documents. Search- ing over such data sources, in many cases, can offer more relevant and ... particular, Li et al. leveraged click- through data and a database to automatically de- rive training data for learning a CRF-based tagger. Manshadi and Li developed a hybrid, gene...

Ngày tải lên: 20/02/2014, 04:20

... or the opposite label of its antonyms if any of them are known. Kanayama and Nasukawa (2006) used syntactic features and context coherency, defined as the ten- dency for same polarities to appear ... Linguistics Identifying the Semantic Orientation of Foreign Words Ahmed Hassan EECS Department University of Michigan Ann Arbor, MI hassanam@umich.edu Amjad Abu-Jbara EECS Departme...

Ngày tải lên: 20/02/2014, 05:20

... GCCCCATGGCGGTGGATGGCATATGGGAGG GGGTACCC PrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACC TCAAGC PrP113–231 CCAACCTCAAGCATATGGCAGGG PrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCC PrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCC PrPD112–136 ... disease termed prion diseases [1,2] make up a small percentage of all human neurodegenerative diseases. Prion diseases have become a major concern because of the possi...

Ngày tải lên: 21/02/2014, 00:20

... SDS/PAGE gave a single band at apparent molecular mass of 34 kDa. The binding affinity of the lectin in the hemolymph of the freshwater crab, Paratelphusa jacquemontii, expressed O-acetyl sialic acid ... Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii Maghil Denis, P. D. Mercy Palat...

Ngày tải lên: 21/02/2014, 00:20