Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

... Linguistics Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German Hip Hop Forum Matt Garley Department of Linguistics University of Illinois 707 S Mathews Avenue Urbana, IL 61801, USA mgarley2@illinois.edu Julia ... classi- fier, using character 1- through 6-grams (including word boundaries) as features. Since we could not manually annotate...

Ngày tải lên: 19/02/2014, 19:20

... precisely, an Fig. 4. N-terminal pegylation of G37 2A- FVIIa and FVIIa. (A) Pegyla- tion of free and TF-bound G37 2A- FVIIa and FVIIa visualized by SDS–PAGE. At each time point, a 12 lL aliquot of the reaction ... bound both variants with the same affinity, and incorporation of an active site inhibitor into FVIIa and G37 2A- FVIIa increased the affinity for sTF in an indi...

Ngày tải lên: 18/02/2014, 08:20

... variety of crops cultivated around the world, including the oilseeds rapeseed and canola (Bras- sica napus and Brassica rapa) and vegetables such ase cabbage (Brassica oleraceae var. capitata), ... Pedras, Zoran Minic and Vijay K. Sarma-Mamillapalle Department of Chemistry, University of Saskatchewan, Saskatoon, Canada Introduction Crucifers (family Brassicaceae, syn. Cruciferae...

Ngày tải lên: 18/02/2014, 14:20

... and F. scutaria larvae sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas, D. melanogaster-2 and D. melanogaster-3 sequences (data not shown). By contrast, R. pachyptila amino acid ... 710–728 RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778 Full-length sequencing of RpCAbr RpCAbrF TAC AAG GAT GCC ATT AGC 613–630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839 RpCAbrR2...

Ngày tải lên: 18/02/2014, 16:20

... promoter of pET-22b(+) vector] as 5¢-primer and 5¢-TCTCCGTAGG GGAGACAAAAGT-3¢,5¢-ATCCCGCGGGGGAAACCT CATC-3¢ and 5¢-CTGTTTGGAC GAACGCAAGATG-3¢ as 3¢-primers for C53S, C175S and W88F variants, respec- tively ... (A) Expanded view of peaks at m ⁄ z 2800.36 and 2832.35 and the fragmentation of the peak at m ⁄ z 2800.36. (B) Expanded view of peaks at m ⁄ z 2934.36 and 2950.35...

Ngày tải lên: 18/02/2014, 17:20

... Tsukihara T, Aoyama H, Yamashita E, Tomizaki T, Yamaguchi H, Shinzawa-Itoh K, Nakashima R, Yaono R & Yoshikawa S (1995) Structures of metal sites of oxidized bovine heart cytochrome c oxidase at ... 140 amino acids, and CybS, 11 kDa, 103 amino acids) with a total of six transmembrane helices. Here we provide a detailed report of the preparation, gene sequencing, N-terminal s...

Ngày tải lên: 19/02/2014, 02:20

... Plasmid pGEM23S.5 contains a shortened intron (380 bp), 26 bp of the 5¢ exon, and 25 bp of the 3¢ exon. Oligo 104 (45 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in ... A expðÀk a  tÞþB expðÀk b  tÞð2Þ A and k a are the percentage and observed rate constant for the fast-reacting pre-RNA, and B and k b are the same parameters for the slow...

Ngày tải lên: 19/02/2014, 07:20

... are ambiguities arising from, for example, asparagine to aspartic acid, or glutamine to glutamic acid changes [14]. The a- conotoxins EpI, PnIA, GIC, GID, AnIA and AnIB contain pairs of asparagine ... and MS, including identification of post-translational modifications Isolation and identification Standard procedures for identification and isolation of a- conotoxins generally inco...

Ngày tải lên: 19/02/2014, 12:20

... Mining comparative entities and predicates (Task 2): Our basic idea for the second task is selecting candidates first and finding answers from the candidates later. We regard each of noun ... represented as a combination of their lexicalization and POS tag. After feature generation, we calculate each probability value of all CE-candidates using SVM. For example, if a...

Ngày tải lên: 20/02/2014, 04:20

... training sets of varying sizes, as well as a test set of 1000 dialogs. Each generated dialog d in each training/test set consisted of a sequence of values for all the observed and unobserved variables: d ... corpora are usu- ally small and sparse. In this work, we propose a method of building user models that does not oper- ate on manually transcribed dialogs, but inst...

Ngày tải lên: 20/02/2014, 09:20