Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... of the las operon Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis Brian Koebmann, Christian Solem...
Ngày tải lên: 19/02/2014, 17:20
... (nm to lm) and stabilize just one protein and thus are gener- ally protein and disease selective, if not specific. Many of the clinically important Fabry disease-asso- ciated a- galactosidase A variants ... A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD. Galactose adm...
Ngày tải lên: 18/02/2014, 16:20
... rapid analysis of libraries of protein variants. Phage- display has proved to be a powerful tool for analyzing protein stability due to the large library size and the robustness of the phage particle ... to the labor-intensive process of generating and characterizing individual mutant proteins, these combinatorial approaches offer the important advantage of sim...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... model. Linear discriminant analysis (LDA).Thisstatistical multivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass variance, ... greatest part of the original data information. In the second part of our work, we focused on the biochemical information available i n infrared s pectra, and we foun...
Ngày tải lên: 21/02/2014, 03:20
Tài liệu Báo cáo khoa học: Hepatic stimulator substance mitigates hepatic cell injury through suppression of the mitochondrial permeability transition pdf
... lysis buffer. The ATP concentration was immediately measured using a Glomax 96 Microplate Luminometer (Promega). Caspase-3 ⁄ 7 activity Caspase activity was detected by using the Caspase-Glo 3 ⁄ 7 Assay ... apoptosis Caspase activation is a key step in DNA damage- induced apoptosis. To further understand the protec- tive effect of HSS against CCCP-induced apoptosis, the ac...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt
... stained at the base and at the tip, with overall very weak staining of the fused carpels. In the root, the central cylinder was stained, whereas the primary root tips and tips of emerging lateral ... strongly stained (a c), GUS expres- sion in cauline leaves was restricted to the base and apex of the lamina (c). Siliques showed staining at their bases and tips (sti...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx
... goal: A, u.¬subst (A, u) ∧ A, u.¬mustadjoin (A, u). We can then send the actions and the initial state and goal specifications to any off -the- shelf planner and obtain the plan in Fig. 3. The straight arrows in the ... every action that has them as their precondition. There may be multiple action instances in the plan that introduce the same atom canadjoin (A, u). In...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx
... spectro- metry. SDS/PAGE was carried out in separating gels containing 15% acrylamide. The following proteins were used as standards: phosphorylase B (97 kDa), bovine serum albu- min (67 kDa), ovalbumin (45 kDa), ... 8cm)(Pharmacia) equilibrated in the same buffer. The flow rate was 2mLÆmin )1 . Molecular mass determination The molecular mass was determined by means of SDS/ PAG...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: "Finite Structure Query: A Tool for Querying Syntactically Annotated Corpora" doc
... need an initialisation step that transforms the NEGRA format into one that can be queried a lot faster. The query format is a compact binary representation of the relations of the trees. Each ... annotated at the Uni- versity of Tiibingen, comprise a German, an En- glish and a Japanese treebank consisting of spo- ken dialogs restricted to the domain of arrangin...
Ngày tải lên: 22/02/2014, 02:20
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... threshold To obtain a cellular model of a- synuclein overexpres- sion, the human neuroblastoma cell line SH-SY5Y was stably transfected with the plasmid containing human a- synuclein cDNA (a- syn). As a control, ... kinase, 60S acidic ribosomal protein P2 (RPLP2), eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12, annexin A2 , annexin A5 , aldolase A, fasci...
Ngày tải lên: 15/02/2014, 01:20