Tài liệu Báo cáo khoa học: The double-stranded RNA-binding motif, a versatile macromolecular docking platform doc

Tài liệu Báo cáo khoa học: The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression ppt

Tài liệu Báo cáo khoa học: The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression ppt

... clear why these RRM domains that are very similar to the classical ones favor interaction with proteins rather than RNA. Conclusion and perspectives The RNA recognition motif is an abundant and ... crucial importance to dramatically enhance the RNA-binding affinity by increasing the protein–RNA interaction network. In most RRM–RNA complexes, the base stacking on the aromatic resi...

Ngày tải lên: 19/02/2014, 17:20

14 428 0
Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx

Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx

... benzo [a] pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases Oksana M. Subach 1 , Diana V. Maltseva 1 , Anant Shastry 2 , Alexander Kolbanovskiy 2 , Saulius Klimas ˇ auskas 3 , ... Wyszynski MW, Gabbara S, Kubareva EA, Romanova EA, Oretskaya TS, Gromova ES, Shabarova ZA & Bhagwat AS (1993) The cysteine conserved among DNA cytosine methylases...

Ngày tải lên: 19/02/2014, 00:20

14 558 0
Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf

Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf

... the genome: a marriage made by evolution. Chromosoma 114, 212–219. 32 Glass CA, Glass JR, Taniura H, Hasel KW, Blevitt JM & Gerace L (1993) The alpha-helical rod domain of human lamins A and C contains ... AM, Columbaro M, Scarano G, Mattioli E, Sabatelli P, et al. (2005) Alterations of nuclear envel- ope and chromatin organization in mandibuloacral dys- plasia, a rare form of l...

Ngày tải lên: 19/02/2014, 02:20

8 510 0
Tài liệu Báo cáo khoa học: "Domain-transcending mappings in a system for metaphorical reasoning" docx

Tài liệu Báo cáo khoa học: "Domain-transcending mappings in a system for metaphorical reasoning" docx

... where the states of affairs themselves have mappees in the target domain, then the change event has a mappee that is a change event between the latter states of affairs. Time-order VNMA: The time-order ... map- pee events. Mental/Emotional States VNMA: If some agents in the source domain have mappees that are also agents, then their mental and emotional states map identicall...

Ngày tải lên: 22/02/2014, 02:20

6 455 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... domain and the functional relationship of tandemly repeated domains in BPPs. We conjecture that dual-domain BPPs have succeeded evolutionarily because they can increase the amount of available ... was determined using the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 usin...

Ngày tải lên: 14/02/2014, 15:20

9 801 0
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

... by the importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma- tional rearrangement that exposes the NLS in an extended conformation. Database Structural data are available ... (excluding water molecules and peptide atoms) and r j is the standard deviation of B factors. The normalized B factors have a zero mean and unit variance. All atoms that satisfy B z...

Ngày tải lên: 14/02/2014, 19:20

14 741 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... SJ, Ward ER, Ryals JA & Dangl JL (1994) Arabidopsis mutants simulating disease resistance response. Cell 77, 565–577. 26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K, Miyao A, Kawasaki T, ... artifi- cial substrate to assess the kinase activity and GST alone was used as a negative control. The top panel shows the kinase assay visualized by autoradiography and the bottom panel...

Ngày tải lên: 14/02/2014, 19:20

11 700 0
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... control to pathways regu- lated by p53, E2F and the pRB family. Acknowledgements G .A. M. was the recipient of a graduate fellowship awarded by the Freistaat Sachsen. Research in our group was supported ... CHR, yielded a further decrease in regulation. The CDE alone was not tested [41]. The CDE mutation that was assayed would also alter a putative CDE site with the standard...

Ngày tải lên: 16/02/2014, 09:20

17 876 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... reagents and the recombinant human TRAIL ⁄ APO 2 ligand were purchased from Invitrogen and Feldan Bio (St-Laurent, QC, Canada), respectively. The caspase 3 substrate (Ac-DEVD-pNA) and the inhibitor substrate ... substrate. Background readings were subtracted from all samples and caspase 3 activity expressed as a fold increase over nontransfected and nontreated control cells. Statistic...

Ngày tải lên: 16/02/2014, 09:20

12 718 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS262 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2) SJS138 TACG AGATCT TAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2) SJS172 GGGATCATGCCCA AGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2) SJS173 AGTAAGGAAAATA AG...

Ngày tải lên: 16/02/2014, 09:20

14 635 0
w