Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspeciﬁc alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

... Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization.Endocrine Rev 15, 439–461.K. Komaru et al. Novel aggregate formation of an alkaline phosphatase frame-shift mutant FEBS ... Journal 272 (2005) 1704–1717 ª 2005 FEBS 1717 Novel aggregate formation of a frame-shift mutant protein of tissue-nonspeciﬁc alkaline phosphatase is ascribed to three cysteine residues in the C-terminal ... were stained for alka-line phosphate activity in the absence orpresence of saponin.K. Komaru et al. Novel aggregate formation of an alkaline phosphatase frame-shift mutant FEBS Journal 272...

Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

... (e.g. The Minister of Finance is done!). There are also cases wherein the opinion is targeting another commentator (e.g. Mr. Francisco de Amarante, did you watch the same debate I did?!?!?), and ... prime the later achieved the lowest percentage of votes in the 2009 parliamentary election. Fig. 2. Polarity distribution per candidate Also interesting is the information contained in the ... and negative opinions? Finally, approaches to opi-nion mining have implicitly assumed that the prob-lem at stake is a balanced classification problem, based on the general assumption that positive...

Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

... the transforming factor heregulin leads to increases in the levels of HSF1 and MTA1 (a component of the NuRDcomplex containing HDAC1 and HDAC2) proteinsand to binding of HSF1 to MTA1 [78]. The ... stress, is involved in the activation and inactivation of the transactivatingability [26]. Interestingly, Saccharomyces HSF is unu-sual among transcriptional activators because it canbypass a need ... retardation and exagger-ated production of the pro -in ammatory cytokinetumour necrosis factor -a, without affecting basal HSPexpression [38]. Although HSF1 gains DNA-bindingand transactivating abilities...

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domainThirumaran Thanabalu1,2, Rajamuthiah Rajmohan2, Lei Meng2, Gang Ren4,5, Parimala R. Vajjhala4and Alan L. Munn1,3,4,6*1 ... foractin-cytoskeleton polarization: a novel C-terminal actin-binding submod-ule (CABS) that contains a novel G-actin-binding domain, which we call a verprolin homology 2 C-terminal (VH2-C) domain; and a second ... the one hand, and in corticalactin-patch polarization, on the other hand, are at leastpartially distinct [23]. However, there may still be a functional link between endocytosis and actin-patchpolarization....

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. ... retinal (atRAL)by a photon induces a conformation change of the visual pigments, triggers the phototransduction cascadeand initiates vision [1,2]. The retinoid visual cycleAbbreviations11cRAL, ... 6, A1 , A2 ). Using this antibody, we examined the localization of RPE65c in the zebraﬁsh retina by immunohisto-chemistry. An intense RPE65c signal was detected in the inner retina near the ganglion...

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... T-cell kinase (ITK) could in uence the infectivity of HIVand also have anti -in ammatory activity. Since 2006, several patients carry-ing a fusion protein, originating from a translocation joining ... domain; arginine 28 is in dark blue, encircled in red. Bottom left: SH2 domain. Right: kinasedomain. The mutated residues are indicated in yellow, a- helices are in cyan, b-sheets are in magenta ... 287–299.27 Plebani A, Soresina A, Rondelli R, Amato GM, AzzariC, Cardinale F, Cazzola G, Consolini R, De Mattia D,Dell’Erba G et al. (2002) Clinical, immunological, andmolecular analysis in a large...

Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

... in various organ systems. Even in organismslacking a brain, such as Caenorhabditis elegans, the nervous system plays a key role in maintaining energybalance [1–4]. In more advanced, mammalian ... higherorganisms, this involves storing energy as fat duringperiods of an abundant food supply to hedge againstperiods of food shortage. Today, humans have pushedstorage too far, to the point of ... catalyzed by ACC – the key reg-ulatory enzyme in the pathway. Malonyl-CoA serves as the basic chain-elongating substrate for the formation of long-chain saturated fatty acids catalyzed by FAS.It...

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... keyregulator of cell survival [12]. Maintaining the balancebetween cell survival and apoptosis is critical in the maintenance of a healthy organism, and tipping the equilibrium in one or another ... through the mitochondrial pathway. The key event in the mito-chondrial pathway is the release of proapoptotic fac-tors from the mitochondrial intermembrane space into the cytosol, resulting in the ... norubiquitylation of intact Bid by Itch. This leads to the suggestion that removal of tBid by proteasomal degra-dation leads to an increase in Bid cleavage, resulting in the disappearance of both Bid and...

Tài liệu Báo cáo khoa học: Anaerobic sulfatase-maturating enzyme – A mechanistic link with glycyl radical-activating enzymes? docx

... information The following supplementary material is available:Fig. S1. MALDI-TOF MS analysis of 17 amino acidpeptides after incubation with anSMEcpe.Fig. S2. MALDI-TOF MS analysis of 17C and ... conditions[12]. In the absence of substrate, the AdoMet reductivecleavage activity of all mutants was identical to thatobtained in the presence of peptide, again indicatingthat all three clusters are ... 5¢-GCCGTA GCC AAC CTC GCA GCC GAA TAC GCC TATTAT-3¢ and 5¢- ATA ATA GGC GTA TTC GGC TGCGAG GTT GGC TAC GGC-3¢; for the C27 6A ⁄ C28 2A mutant, 5¢-GGC GTA GCT ACA ATG GCG AAG CATGCC GGA CAT-3¢ and...

Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

... Ltd. The targeting sequence of the siRNAagainst rat TRAP1 was 5¢-CAACAGAGATTGATCAAAT-3¢. A negative control adenovirus vector containingnonspeciﬁc siRNA was constructed in the same way (non-speciﬁc ... protein 1 (TRAP1) is a mito-chondrial chaperone that plays a role in maintaining mitochondrial func-tion and regulating cell apoptosis. The opening of the mitochondrialpermeability transition ... cardiomyocytes. Because TRAP1 is a mitochondrial chaperone, it has an important role in regulating cell apoptosis and maintaining mitochon-drial homeostasis and function. Silencing TRAP1enhances cytochrome...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ