Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... pGL3e:Prm 3a AP)1 *, pGL3b:Prm3ab AP)1 *, pGL3e: Prm3ab AP)1 *, pGL3b: Prm3aa AP)1 *, pGL3e:Prm3aa AP)1 *, pGL3b:Prm3aaa AP)1 * and pGL3e:Prm3aaa AP)1 *. Mutation of the Oct-1 element with the ... sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATC...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... from human adenocarcinomas Anna Maria Luciani 1 , Sveva Grande 1 , Alessandra Palma 1 , Antonella Rosi 1 , Claudio Giovannini 2 , Orazio Sapora 3 , Vincenza Viti 1 and Laura Guidoni 1 1 Dipartimento ... irradiated: black) and A ⁄ (Lys + Ala) (controls: dotted white; irradiated: dotted black) as obtained from 1D and 2D COSY spectra of HeLa and MCF-7 cell samples. Data are th...

Ngày tải lên: 18/02/2014, 13:20

14 765 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... (5¢-GCATAGCGATGTGGACGA -3 ) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA -3 ). The abbreviations ‘Qs’ and ‘Qa’ refer, respectively, to sense and antisense primers. Accurate amplification of the target amplicon was checked by obtaining ... and is characterized by the degeneration of larval tissues, such as the velum and the foot, and the remodelling of larval tissues to pro...

Ngày tải lên: 19/02/2014, 00:20

9 584 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... Delineation of the molecular basis for our observations is essential to evaluate the elevated DNase I activity in the sera of patients with AMI and to validate the use of serum DNase I activity as ... cells and a primer set of the forward pri- mer DN-5R and the reverse primer DN+854X (sequences 5¢-CG GAATTCTCAGGATGAGGGGCATGAAG -3 and 5¢-CG CTCGAGGCTGCTCACTT...

Ngày tải lên: 19/02/2014, 06:20

12 610 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... Characterization of the interaction between the plasma membrane H + -ATPase of Arabidopsis thaliana and a novel interactor (PPI1) Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... primers: gatggatcccatATGGGTG TTGAAGTTGTA annealing around the start codon of the Ppi1 ORF and gactcgagATTAGTCGACTTCTTACGC annealing just before the putative transmembrane domai...

Ngày tải lên: 19/02/2014, 07:20

8 629 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-GACACCGTAGGTTGAGCCGCCAATC GTCCC -3 ; NP5, 5¢-CTTTAACTTGTTGGGCACTGG CATTG -3 ; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA -3 along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC -3 ) and AP2 ... endo- and exo- peptidases are widespread in nature and found in viruses, archaea, bacteria and euk- aryotes. The biological importance of peptidases are clearly indicated by the...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

... 5¢-TAT GGATCCTTAATTAGAAACAAACTGTCTGA TAAAC P2OH 5¢- CTCGAGATTAGAAACAAACTGTCTGATAAACC P1Z 5¢-ATA CCATGGCTGGAGAAGACTTTAAGATC P1ZH 5¢- CATATGACTGGAGACTTTAAGATC P2Z 5¢-TAT GGATCCTCACCACCCAATTTCGGAAAG P2ZH ... Symbols O, Z and H stand for Sno1p, Snz1p and His-tag, respectively. Underlined are the restriction enzyme sites. Primer Sequence P1O 5¢-ATA CCATGGACAAAACCCACAGTACAATG P1OH 5¢- CAT...

Ngày tải lên: 19/02/2014, 12:20

8 650 0
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

... depolymerization of chitosan by pronase and characterization of the resultant products Acharya B. Vishu Kumar 1 , Lalitha R. Gowda 2 and Rudrapatnam N. Tharanathan 1 1 Department of Biochemistry and ... 15 13 1518. 41. Watanabe,T.,Kobori,K.,Kiyotaka,Miyashita,Fujii,T.,Sakai, H. & Makot, Uchida and Tanaka, H. (19 93) Identification of glutamic acid 204 and aspartic aci...

Ngày tải lên: 19/02/2014, 12:20

11 674 0
Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

... Àðk A =k 0 Þ= A ð1Þ where k A and k 0 are the inactivation rate constants either in the presence or in the absence of various concentrations of a ligand A, k 2 and k 1 are the rate constants of ... legitimate to apply the Scrutton and Utter equation [40] to the inhibition data. Data analyses Data were analysed by means of sigmaplot 2001 (SPSS Science Soft...

Ngày tải lên: 20/02/2014, 01:20

15 589 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... the parallel b-helix Fig. 1. Schematic organization of the pectinase gene cluster in T. maritima (TM0 433 -04 43) . pelA and pelB are shown as grey arrows. Adja- cent genes are a- glucuronidase (agu), ... Erwinia carotovora (CAA35998.1), PehX Erwinia chrysanthemi (AAA24842.1), Ralstonia solanacearum K60 PehC (AAL24 033 .1), PG Thermoanaerobacterium thermosulfurigenes (AAB08040....

Ngày tải lên: 20/02/2014, 03:20

10 592 0
w