Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

... Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) Justin A. MacDonald 1 and Kenneth B. ... increasing the pH slightly to a value of 7.3 dramatically altered the effect of phosphate and activation was seen only at low concentrations with a maximal 1.7-fold...

Ngày tải lên: 19/02/2014, 16:20

9 579 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites of ... for phosphorus scavenging and remobilization when the cells are under stress and consequently mononucleotide phosphate concentrations are high. Materials and methods Cloning an...

Ngày tải lên: 18/02/2014, 14:20

10 554 0
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx

Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx

... grade) was from Collaborative Bio- medical (Bedford, MA, USA). Monoclonal and polyclonal antibodies against IRb, polyclonal antibodies against EGF and polyclonal antibodies against Grb7 were from ... antibody against EEA1 (clone 14) was from BD Transduction Laboratories (San Jose, CA, USA). Monoclonal antibody against Na + ⁄ K + -ATPase a- subunit (clone M7-PB-E9) and polyclonal...

Ngày tải lên: 18/02/2014, 18:20

15 497 0
Tài liệu Báo cáo khoa học: Unfolding and aggregation during the thermal denaturation of streptokinase pptx

Tài liệu Báo cáo khoa học: Unfolding and aggregation during the thermal denaturation of streptokinase pptx

... high temperatures with the formation of high molecular mass aggregates of SK. The maximum degree of aggregation occurs at high sample concentrations and at temperatures where domain A unfolds, and ... reversible because state A n can dissociate and unfold at high temperatures. Nevertheless, association and dissociation can be slow at certain temperatures and therefore kine...

Ngày tải lên: 21/02/2014, 03:20

13 504 0
Báo cáo khoa học: Temperature and salts effects on the peptidase activities of the recombinant metallooligopeptidases neurolysin and thimet oligopeptidase pdf

Báo cáo khoa học: Temperature and salts effects on the peptidase activities of the recombinant metallooligopeptidases neurolysin and thimet oligopeptidase pdf

... and salt concentration. The relative amount of cleavage varied with the nature of the substitution at the X position as well as with temperature and NaCl concentration. TOP was activated by all ... to nonlinear least square plot of Eqn (1). The overall V max was obtained from Eqn (1), whereas the separate values for V a max and V b max were calculated using the ratio of th...

Ngày tải lên: 23/03/2014, 21:21

9 558 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

... is the only activity able to convert pyruvate into acetyl-CoA. Two redundant pathways for acetate assimilation are needed as a result of a coupling between the TCA cycle and acetate activation to acetyl-CoA by ... level is a key regulator of the rate of mitochondrial respiration in the heart allowing ATP and creatine phosphate levels to maintain relatively constant over a...

Ngày tải lên: 14/02/2014, 14:20

91 733 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

... Georgiou A, Szutorisz H, Maia e Silva A, Pombo A, Barahona I, Dargelos E, Canzonetta C & Dillon N (2005) Variant histone H3.3 marks promot- ers of transcriptionally active genes during mammalian cell ... cyclical process is accompanied by transient sequential histone acetylation and deacetyla- tion, and transient recruitment of remodellers and transcription factors. A cycl...

Ngày tải lên: 14/02/2014, 18:20

29 743 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

... UGUUGUUUUAGUGAUCAGAAGGU GY-box family miRNA Brd-box: 5´ AGCUUUA ||||||| dme-miR-4 3´ AGUUACCAACAGAUCGAAAUA dme-miR-79 3´ UACGAACCAUUAGAUCGAAAUA Brd-box family miRNAs K-box: 5´ cUGUGAUa |||||| dme-miR- 2a ... cycle Cell survival miR-278 Site1: Expanded UTR 5´ AAAUGUAAACGAAAA-CCCACCGU ||||| |||||| ||||||| dme-miR-278 3´ UUUGCC UGCUUUCAGGGUGGCU site2: Expanded UTR 5´ AGAUGGUAAAAUACACGAG CC...

Ngày tải lên: 14/02/2014, 19:20

9 684 0
Tài liệu Báo cáo khoa học: MicroRNAs and epigenetics doc

Tài liệu Báo cáo khoa học: MicroRNAs and epigenetics doc

... understanding of diseases. Materials and methods Typing of miRNAs by positional relationship to mRNA transcripts Information about the localization and strand direction of 939 miRNAs, 35245 Refseq genes and ... excluded from the Refseq data set. Using matlab, version 201 1a (Mathworks, Natick, MA, USA), we compared localization and strand direction between miRNAs and transc...

Ngày tải lên: 14/02/2014, 19:20

12 636 0
Tài liệu Báo cáo khoa học: MicroRNAs and cardiovascular diseases ppt

Tài liệu Báo cáo khoa học: MicroRNAs and cardiovascular diseases ppt

... cardiomyopathies, and heart failure and can be defined as an inappropriate accumulation of extracellular matrix proteins in the heart [69–74]. Car- diac fibrosis leads to an increased mechanical ... sarcoplasmic reticulum junction, and are activated by membrane depolariza- tion. I caL is important in heart function because it modulates action potential shape and contributes to pacemak...

Ngày tải lên: 14/02/2014, 19:20

15 684 0
Từ khóa:
w