Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

... CW, Malapeira J, Colome N, Moss M, Canals F & Arribas J (2008) Metastasis -associated C4. 4A, a GPI-anchored protein cleaved by ADAM10 and ADAM17. Biol Chem 389, 1075–1084. 60 Janes PW, Saha N, ... Colciaghi F, Marcello E, Borroni B, Zimmermann M, Caltagirone C, Cattabeni F, Padovani A & Di LM (2004) Platelet APP, ADAM 10 and BACE alterations in the early stages of Alzheimer dise...

Ngày tải lên: 16/02/2014, 09:20

... 5¢-CGCCTCGAGCTATTTGGGCTCTT TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢- CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAG CTAAGAGTCAG CTTGCACGTC-3 ¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATG...

Ngày tải lên: 18/02/2014, 17:20

... hallmark of cancer cells is a deregulation of cellular proliferation [55]. The assess- ment of cellular proliferation in histological material is a valuable component of conventional histopathologi- cal ... reactive with a human nuclear antigen associated with cell prolifer- ation. Int J Cancer 31, 13–20. 27 Gerdes J, Lemke H, Baisch H, Wacker HH, Schwab U & Stein H...

Ngày tải lên: 19/02/2014, 00:20

... mtDNA mutations associated with Leber’s hereditary optic neuropathy Maura Floreani 1 , Eleonora Napoli 1,2 , Andrea Martinuzzi 2 , Giorgia Pantano 2 , Valentina De Riva 2 , Roberta Trevisan 1,2 , ... MnSOD and CuZnSOD proteins are possibly upregulated as a compensatory mechanism, but may be partially inactivated by oxidative damage. Complex I impairment in a variety of human diseases...

Ngày tải lên: 19/02/2014, 16:20

... TAT ATG T Weak 3 aa 2 ⁄ 4 55067 TCA ATG C Weak 58 aa 3 33 39% 60929 60933 60939 GTA ATG C TGC ATG T TCC ATG G G Adequate Weak Adequate 13 aa 33 aa 31 aa 3¢ 76 49% – 4¢ 56 61% 61041 GGA ATG T Adequate ... obvious retrieval signal is missing. The human phospholipases D1 and D2 are mainly associated with the plasma membrane or with the membranes of intracellular organelles although they...

Ngày tải lên: 19/02/2014, 17:20

... 2717 KIPase activity is a novel caspase-like activity associated with cell proliferation Cahora Medina-Palazon, Emmanuelle Bernard, Victoria Frost, Simon Morley and Alison J. Sinclair Biochemistry Department, ... substrate for caspase 1; Ac-IETD-AMC is a substrate for caspase 8 and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, 5 and 9. Ac-DVPD-AMC, Ac-DPSD-AM...

Ngày tải lên: 19/02/2014, 13:20

... Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme. Pure Appl Chem 77, 281–289. 20 Parthasarathy S, Ravindra G, Balaram H, Balaram ... mutagenesis. Desired mutation Template gene Constructed mutant Primer sequence (5¢-to3¢) Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTAT...

Ngày tải lên: 18/02/2014, 11:20

... best case, because an oxidative degradation of the catalyst occurred. This was shown by a progressive disappearance, in its absorption spectrum, of the soret band at 396 nm that is characteristic ... abzymes; nitrosoalcanes; microperoxidase 8; S-oxidation. Catalytic antibodies with a metalloporphyrin cofactor, or ÔhemoabzymesÕ, are not as efficient a category of catalysts as their na...

Ngày tải lên: 19/02/2014, 12:20

... Gram-positive bacteria [36], a signal peptide of 70 amino acids is not in agreement with this multi- variate data analysis. Therefore, the simplest explan- ation would be that the N-terminus of the mature ... pneumoniae, although a SPase I activity has been shown to be essential for cell viability in all bacteria analyzed [26]. To test experimentally whether there is a type I...

Ngày tải lên: 19/02/2014, 18:20

... via a separate cADPR binding protein. In addition to Ca 2+ release, cADPR also evokes Ca 2+ entry. The underlying mechanism(s) may comprise activation of capacitative Ca 2+ entry and ⁄ or activation ... from NAD by CD38-type ADPRC and which is also a breakdown product of cADPR (Fig. 2). TRPM2 is a Ca 2+ - and Na + -permeable cation channel that is mainly expressed in the brain and...

Ngày tải lên: 20/02/2014, 01:20