Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx

Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx

... CW, Malapeira J, Colome N, Moss M, Canals F & Arribas J (2008) Metastasis -associated C4. 4A, a GPI-anchored protein cleaved by ADAM10 and ADAM17. Biol Chem 389, 1075–1084. 60 Janes PW, Saha N, ... Colciaghi F, Marcello E, Borroni B, Zimmermann M, Caltagirone C, Cattabeni F, Padovani A & Di LM (2004) Platelet APP, ADAM 10 and BACE alterations in the early stages of Alzheimer dise...

Ngày tải lên: 16/02/2014, 09:20

12 591 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... 5¢-CGCCTCGAGCTATTTGGGCTCTT TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢- CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAG CTAAGAGTCAG CTTGCACGTC-3 ¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATG...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

... hallmark of cancer cells is a deregulation of cellular proliferation [55]. The assess- ment of cellular proliferation in histological material is a valuable component of conventional histopathologi- cal ... reactive with a human nuclear antigen associated with cell prolifer- ation. Int J Cancer 31, 13–20. 27 Gerdes J, Lemke H, Baisch H, Wacker HH, Schwab U & Stein H...

Ngày tải lên: 19/02/2014, 00:20

16 505 0
Tài liệu Báo cáo khoa học: Antioxidant defences in cybrids harboring mtDNA mutations associated with Leber’s hereditary optic neuropathy docx

Tài liệu Báo cáo khoa học: Antioxidant defences in cybrids harboring mtDNA mutations associated with Leber’s hereditary optic neuropathy docx

... mtDNA mutations associated with Leber’s hereditary optic neuropathy Maura Floreani 1 , Eleonora Napoli 1,2 , Andrea Martinuzzi 2 , Giorgia Pantano 2 , Valentina De Riva 2 , Roberta Trevisan 1,2 , ... MnSOD and CuZnSOD proteins are possibly upregulated as a compensatory mechanism, but may be partially inactivated by oxidative damage. Complex I impairment in a variety of human diseases...

Ngày tải lên: 19/02/2014, 16:20

12 548 0
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

... TAT ATG T Weak 3 aa 2 ⁄ 4 55067 TCA ATG C Weak 58 aa 3 33 39% 60929 60933 60939 GTA ATG C TGC ATG T TCC ATG G G Adequate Weak Adequate 13 aa 33 aa 31 aa 3¢ 76 49% – 4¢ 56 61% 61041 GGA ATG T Adequate ... obvious retrieval signal is missing. The human phospholipases D1 and D2 are mainly associated with the plasma membrane or with the membranes of intracellular organelles although they...

Ngày tải lên: 19/02/2014, 17:20

9 518 0
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

... 2717 KIPase activity is a novel caspase-like activity associated with cell proliferation Cahora Medina-Palazon, Emmanuelle Bernard, Victoria Frost, Simon Morley and Alison J. Sinclair Biochemistry Department, ... substrate for caspase 1; Ac-IETD-AMC is a substrate for caspase 8 and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, 5 and 9. Ac-DVPD-AMC, Ac-DPSD-AM...

Ngày tải lên: 19/02/2014, 13:20

8 443 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme. Pure Appl Chem 77, 281–289. 20 Parthasarathy S, Ravindra G, Balaram H, Balaram ... mutagenesis. Desired mutation Template gene Constructed mutant Primer sequence (5¢-to3¢) Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTAT...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... best case, because an oxidative degradation of the catalyst occurred. This was shown by a progressive disappearance, in its absorption spectrum, of the soret band at 396 nm that is characteristic ... abzymes; nitrosoalcanes; microperoxidase 8; S-oxidation. Catalytic antibodies with a metalloporphyrin cofactor, or ÔhemoabzymesÕ, are not as efficient a category of catalysts as their na...

Ngày tải lên: 19/02/2014, 12:20

7 448 0
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

... Gram-positive bacteria [36], a signal peptide of 70 amino acids is not in agreement with this multi- variate data analysis. Therefore, the simplest explan- ation would be that the N-terminus of the mature ... pneumoniae, although a SPase I activity has been shown to be essential for cell viability in all bacteria analyzed [26]. To test experimentally whether there is a type I...

Ngày tải lên: 19/02/2014, 18:20

9 559 1
Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc

Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc

... via a separate cADPR binding protein. In addition to Ca 2+ release, cADPR also evokes Ca 2+ entry. The underlying mechanism(s) may comprise activation of capacitative Ca 2+ entry and ⁄ or activation ... from NAD by CD38-type ADPRC and which is also a breakdown product of cADPR (Fig. 2). TRPM2 is a Ca 2+ - and Na + -permeable cation channel that is mainly expressed in the brain and...

Ngày tải lên: 20/02/2014, 01:20

8 469 0
w