Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

... 2681 Molecular and biochemical characterization of D -phosphoglycerate dehydrogenase from Entamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated ... suggesting that this parasite possesses both phosphorylated and nonphosphorylated pathways. We showed that GDH probably plays a role...

Ngày tải lên: 19/02/2014, 13:20

... Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani He ´ ctor Villa 1 , Yolanda Pe ´ rez-Pertejo 1 , Carlos Garcı ´ a- Estrada 1 , Rosa M. Reguera 1 , ... Jose ´ Marı ´ a Requena 2 , Babu L. Tekwani 3 , Rafael Balan ˜ a- Fouce 1 and David Ordo ´ n ˜ ez 1 1 Departamento de Farmacologı ´ a y Toxicologı ´ a (INTOXCAL), Facultad de Veterin...

Ngày tải lên: 21/02/2014, 00:20

... sites using a forward oligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence ... Gly-Gly-Cys sequence was introduced at the C-terminus using oligomers 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGA...

Ngày tải lên: 19/02/2014, 06:20

... Morishita F, Nakanishi Y, Kaku S, Furukawa Y, Ohta S, Hirata T, Ohtani M, Fujisawa Y, Muneoka Y & Matsushima O (1997) A novel D-amino-acid-containing peptide isolated from Aplysia heart. Biochem ... antisera r-anti-l (made in rat) and gp-anti-dW4 (produced in guinea pig), two antisera discriminating CHH isomers (gp-anti-pQl made in guinea pig and rb-anti- pQd in rabbit) [38] and a...

Ngày tải lên: 18/02/2014, 11:20

... mori Kei Urano 1 , Takaaki Daimon 1 , Yutaka Banno 2 , Kazuei Mita 3 , Tohru Terada 4 , Kentaro Shimizu 4,5 , Susumu Katsuma 1 and Toru Shimada 1,4 1 Department of Agricultural and Environmental Biology, ... Koike Y, Nohata J, Kawasaki H, Kadono-Okuda K, Yamamoto K, Suzuki MG, Shimada T et al. (2003) The construction of an EST database for Bombyx mori and its application. Proc Natl Acad...

Ngày tải lên: 18/02/2014, 04:20

... genome with a GTG start. Sense primer, 5¢-GAGAGACATATGCCA TCGGCCATTTTAAAG-3¢; antisense primer, 5¢ -GAGA GAAAGCTTCTAACGCAGGGAGAAAAC-3¢. An alter- native start site would be the in-frame ATG, 30 nucleotides downstream ... incor- porate suitable restriction sites (NdeI-HindIII) into the 5¢- and 3¢ ends of the product. Sense primer, 5¢-GAGA GAGGATCCATATGACAAAAACCGAGTTAC-3¢, NdeI site; antise...

Ngày tải lên: 19/02/2014, 17:20

... large body of independent data collected on Calb and truncated Calbs by Kumar’s group. This latter work revealed that EF-hands II and VI of Calb do not bind calcium and that Calb binds a total ... Groves 1 , Attila Ambrus 2, *, Agata Kaleta 1 , Katalin E. Ko¨ve ´ r 3 , Gyula Batta 4 and Jacek Kuz ´ nicki 1,5 1 Department of Molecular and Cellular Neurobiology, Nencki Institu...

Ngày tải lên: 22/02/2014, 07:20

... function ugcgucugaca UGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg At5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 ... to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCAC CATGTTGCTACTGAATTTCTGCA-3¢ (reverse) to APUM-7. Qua...

Ngày tải lên: 18/02/2014, 06:20

... subunit molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activity of HYD Js with d-p- HPH as substrate was ... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamo...

Ngày tải lên: 18/02/2014, 08:20

... (TaKaRa Bio Inc.). Forward primers 5¢-CG TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA CAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi- trogen Corporation) and reverse primers 5¢-AAGTAGGCA ACAAAACAACG-3¢ and ... 77–99. 16 Kamauchi S, Wadahama H, Iwasaki K, Nakamoto Y, Nishizawa K, Ishimoto M, Kawada T & Urade R (2008) Molecular cloning and characterization of two soybean protein disulfide i...

Ngày tải lên: 18/02/2014, 11:20