Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... the association of the variable heavy chain (V H )with protein A was used as a surrogate for direct stability measurements. The V H domains in camelid heavy chain antibodies are most similar to ... Another major focus has been to obtain quanti- tative data on b-sheet stability determinants. We have suc- cessfully adapted a phage-display method for quantitating a nities o...

Ngày tải lên: 19/02/2014, 12:20

... Geneva tanja.samardzic@unige.ch Abstract We present a novel approach to the task of word lemmatisation. We formalise lemmati- sation as a category tagging task, by describ- ing how a word-to-lemma transformation rule can ... European languages having different morpho- logical complexity, including agglutinative (Hungar- ian, Estonian) and fusional (Slavic) languages. 2 Lemmatisation...

Ngày tải lên: 19/02/2014, 19:20

... of a word as its vari- able. Each agent w i is associated with the variable s w i . The value assigned to this variable indicates the sense assigned by the algorithm. 3.3 Domains Senses of a word ... approaches: These approaches crucially rely on lexical knowledge base. Graph-based WSD approaches (Agirre and Soroa, 2009; Sinha and Mihalcea, 2007) per- form disambiguation over a graph...

Ngày tải lên: 20/02/2014, 04:20

... of data available for these experiments all these pa- rameters were hand-tunned. 4.2 Qualitative evaluation The system was executed using all the available information, with the same parametric ... present a method for learn- ing the basic patterns contained within a plan and the ordering among them. As training data, we use semantically tagged transcripts of domain ex- perts perfor...

Ngày tải lên: 20/02/2014, 18:20

... dehydrogenase-ferrochelatase from Saccharomyces cerevisiae), we found that the two proteins had 24% sequence similarity. A crystal structure of Met8P has shown that this protein has an aspartate residue ... 111–127. 13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997) Gene cluster for dissimilatory nitrite reductase (nir) from Pseudomonas aeruginosa: sequencing and identifi- cation of...

Ngày tải lên: 15/02/2014, 01:20

... C), for pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA ... to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin –1 . Name Sequence ssDNAS d(CATTCCCACCGGGACCACCAC) ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC) ETS-1...

Ngày tải lên: 15/02/2014, 01:20

... red). Table 1. Average distances between CA atoms of the stefins and catalytic residues of cysteine proteases. Distance calculated d (A ˚ ) Papain–stefin B 23.93 Cathepsin H–stefin A 23.36 ± 0.23 Cathepsin ... the P1 data set is a consequence of highly anisotropic diffrac- tion, which forced us to discard part of the collected data to maintain reasonable merging statistics. The anisotropy w...

Ngày tải lên: 18/02/2014, 04:20

... followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG- 3¢. The cDNA was subcloned into ... [43–49]. Acknowledgements The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P. McMahon for providing the full-length mou- se Shh cDNA; Dr Neil Cashm...

Ngày tải lên: 18/02/2014, 16:20

... humor/sarcasm recognition merits direct ap- plication to the areas such as information retrieval (Friedland and Allan, 2008), sentiment classifica- tion (Mihalcea and Strapparava, 2006), and human- computer ... lends itself as an ideal ontological resource for script generation. As a network that connects everyday concepts and events with a set of causal and spatial relationships,...

Ngày tải lên: 19/02/2014, 19:20

... results as a set of (labelled) clusters rather than as a ranked list (Carpineto et al., 2009). • Complementing search results with search suggestions (e.g. ”oasis band”, ”oasis fash- ion store”) that ... systems, because the algorithms provide an answer for every page containing text (actual coverage is 94% because some pages only contain text as part of an image file such as pho...

Ngày tải lên: 20/02/2014, 04:20