Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
... 2004 Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure Carolina A ˚strand1,*, Tomas Klenka1,*, O¨rjan Wrange1 and ... the results of others, highlight the pleiotropic effects that TSAadministration has on chromatin structure and on geneexpression.Materials and methodsDNA and plasmidsConstruction of the MMTV reporter ... addition of TSA.To monitor the acetylation status of the MMTV promoter subjected to TSA treatment, we used a chromatin immunoprecipitation assay (ChIP) and evaluated the acetylation status of...
- 10
- 500
- 0
Tài liệu Báo cáo khoa học: Phylogenetic relationships in class I of the superfamily of bacterial, fungal, and plant peroxidases pptx
... [36]. The second subbranch isparticularly interesting: the APX gene of a red algae(Galdieria partita) has a common origin with APXs fromgreen algae (Chlamydomonas sp. and Chlamydomonasreinhardtii) ... unrelatedmicro-organisms. In the case of KatGs, it was firstproposed to occur between archaea and eubacteria based on the analysis of three archaeal and 16 bacterial KatGs[42]. Later it was postulated ... thaliana and Nicotiana tabacum) on d ifferent evolutionary branches. T heAPX from a human parasite Trypanosoma cruzi (belongingto Euglenozoa) segregated at the beginning of the evolutionof...
- 13
- 512
- 0
Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx
... competition at the level of membrane structu res implicated in the T at peptide uptake i sunder evaluation.Comparative FACS analysis of the internalization of the full-length Tat protein construct and ... the Tat-containing recombinant proteins and call other reasonsto explain the differences in the mechanism of internaliza-tion between the CPP peptide and the Tat-containingproteins. A long this ... of t he Tat peptide, in keep ing withseparate internalization pathways. Internalization of the Tat±GFP fusion construct in these conditions was poorlyef®cient in the A- 745 clone (Fig. 4, Panel...
- 8
- 485
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Miyazawa K, Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocytegrowth ... Technology, Nagatsuta,Midori-ku, Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane ... underreducing conditions and stained with Coomassie Bril-liant Blue. The incubation generated two main bands of 60 and 32 kDa (Fig. 4A) . The sizes correspondedto the heavy chain and light chain of activated...
- 13
- 641
- 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... confirmed by CAS assay-guided fractionation of medium-scale fermentationextractions. A comparison of the masses found in the CAS-reactive fraction and the m ⁄ z of the labeled prod-uct revealed ... Structural and func-tional characterization was carried out relying on NMR and MSnanalysis and derivatization-basedelucidation of the overall stereochemistry. Further-more, the functional properties ... facilitates the identification of new natural prod-ucts of the orphan pathway and has successfully beenapplied in the discovery of orfamide A [17]. The accu-rate prediction of adenylation domain...
- 14
- 614
- 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads in the plate wells, and addition of donorbeads ... Biotin-TCGACTAGAAGCTTCTAGAAGCTTCTAGHSE antisense AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... minPAGEPipet to plate, add A beads and incubate+16 hD1 hAutoradiographyAdd D beads and incubateD A O2Read AlphaLISA signal at 615 nmHSEFig. 1. Comparison of EMSA and TransLISA for the...
- 9
- 457
- 0
Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt
... for a full description of the protein preparation and purification details). Followingisolation and purification, the S-tag fusion peptide wascleaved from the domain, generating the isolated a ... mechanism are that the partially metallated and metal-free species are stable intermediates, and thus may have a poten-tial role in the currently undefined function of metallothionein.Abbreviations a- rhMT ... Journal compilation ª 2007 FEBS 2257 on the a domain of human MT- 1a [29] showed that the single remaining metal ion in the demetallationreaction was the C-terminal metal ion, indicating thatoccupancy...
- 9
- 533
- 0
Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt
... clinical phases Ior II, and prevention through vaccination has become a major priority on the agendas of the World Health Organization and of national ministries of health and military organizations. ... proteases of viral and host origin. Outside the ORF, there are the 5¢- and 3¢-UTRs, which have sec-ondary structure and are crucial in the initiation and regulation of translation, replication and ... years as a result of the expansion of the Aedes aegypti mosquito to dif-ferent geographic areas, and DHF has spread fromSouth East Asia to the Western Pacific and the Americas. A substantial...
- 17
- 462
- 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
... TRAIL,relative to TRAIL alone.In view of the cleavage of caspase substrates such asBID and PARP, the effect of IFNa and TRAIL on the DNA content of MCF-7 cells was also assessed,using fluorescence-activated ... apoptosis but also the ability of TRAIL toregulate the initiation of translation at the level of eIF 2a phosphorylation and 4E-BP1 dephosphoryla-tion.Results Effects of IFNa treatment on the sensitivity ... extent of activation of caspase-8 by TRAIL, thus provi-ding a likely explanation for the sensitization of cells to the inhibition of translation.Abbreviations4E-BP, eukaryotic initiation factor...
- 11
- 679
- 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ ,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. ... the total radioactivity on the filter, and qcAMP and qAMPare the precipitation efficiencies of cAMP and AMP, respectively.In all experiments, < 20% of the substrate was hydrolysed, and all ... enzymewas inactivated, removal of the EDTA and the addition of Mg2+did not restore its activity. Gel filtration analysis of recombinant TbPDE1 demonstrated a marked difference inmigration of the...
- 11
- 566
- 0
Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ