Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... 2004 Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure Carolina A ˚ strand 1, *, Tomas Klenka 1, *, O ¨ rjan Wrange 1 and ... the results of others, highlight the pleiotropic effects that TSA administration has on chromatin structure and on gene expression...

Ngày tải lên: 19/02/2014, 12:20

... [36]. The second subbranch is particularly interesting: the APX gene of a red algae (Galdieria partita) has a common origin with APXs from green algae (Chlamydomonas sp. and Chlamydomonas reinhardtii) ... unrelated micro-organisms. In the case of KatGs, it was first proposed to occur between archaea and eubacteria based on the analysis of three archaeal and 16 bacte...

Ngày tải lên: 19/02/2014, 16:20

... competition at the level of membrane structu res implicated in the T at peptide uptake i s under evaluation. Comparative FACS analysis of the internalization of the full-length Tat protein construct and ... the Tat-containing recombinant proteins and call other reasons to explain the differences in the mechanism of internaliza- tion between the CPP peptide and t...

Ngày tải lên: 21/02/2014, 03:20

... Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth ... Technology, Nagatsuta, Midori-ku, Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction...

Ngày tải lên: 15/02/2014, 01:20

... confirmed by CAS assay- guided fractionation of medium-scale fermentation extractions. A comparison of the masses found in the CAS-reactive fraction and the m ⁄ z of the labeled prod- uct revealed ... Structural and func- tional characterization was carried out relying on NMR and MS n analysis and derivatization-based elucidation of the overall stereochemistry. Fu...

Ngày tải lên: 16/02/2014, 09:20

... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads in the plate wells, and addition of donor beads ... Biotin-TCGACTA GAAGCTTCTAGAAGCTTCTAG HSE antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTC...

Ngày tải lên: 18/02/2014, 14:20

... for a full description of the protein preparation and purification details). Following isolation and purification, the S-tag fusion peptide was cleaved from the domain, generating the isolated a ... mechanism are that the partially metallated and metal-free species are stable intermediates, and thus may have a poten- tial role in the currently undefined function of...

Ngày tải lên: 19/02/2014, 00:20

... clinical phases I or II, and prevention through vaccination has become a major priority on the agendas of the World Health Organization and of national ministries of health and military organizations. ... proteases of viral and host origin. Outside the ORF, there are the 5¢- and 3¢-UTRs, which have sec- ondary structure and are crucial in the initiation...

Ngày tải lên: 19/02/2014, 00:20

... TRAIL, relative to TRAIL alone. In view of the cleavage of caspase substrates such as BID and PARP, the effect of IFNa and TRAIL on the DNA content of MCF-7 cells was also assessed, using fluorescence-activated ... apoptosis but also the ability of TRAIL to regulate the initiation of translation at the level of eIF 2a phosphorylation and 4E-BP1 dephosphoryla-...

Ngày tải lên: 19/02/2014, 06:20

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ ,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... the total radioactivity on the filter, and q cAMP and q AMP are the precipitation efficiencies of cAMP and AMP, respe...

Ngày tải lên: 19/02/2014, 12:20