Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... from human adenocarcinomas Anna Maria Luciani 1 , Sveva Grande 1 , Alessandra Palma 1 , Antonella Rosi 1 , Claudio Giovannini 2 , Orazio Sapora 3 , Vincenza Viti 1 and Laura Guidoni 1 1 Dipartimento ... irradiated: black) and A ⁄ (Lys + Ala) (controls: dotted white; irradiated: dotted black) as obtained from 1D and 2D COSY spectra of HeLa and MCF-7 cell samples. Data are the mea...

Ngày tải lên: 18/02/2014, 13:20

14 765 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... (5¢-GCATAGCGATGTGGACGA-3¢) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). The abbreviations ‘Qs’ and ‘Qa’ refer, respectively, to sense and antisense primers. Accurate amplification of the target amplicon was checked by obtaining ... and is characterized by the degeneration of larval tissues, such as the velum and the foot, and the remodelling of larval tissues to produ...

Ngày tải lên: 19/02/2014, 00:20

9 584 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... (Promega), followed by assay of DNase I and b-galactosidase activities, according to a previously described method [32]. Preparation of nuclear extracts and EMSA The nuclear extract and probe were prepared as reported previously ... cells and a primer set of the forward pri- mer DN-5R and the reverse primer DN+854X (sequences 5¢-CG GAATTCTCAGGATGAGGGGCATGAAG-3¢ and...

Ngày tải lên: 19/02/2014, 06:20

12 610 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... Characterization of the interaction between the plasma membrane H + -ATPase of Arabidopsis thaliana and a novel interactor (PPI1) Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... plasma membrane receptor and the activation of the plasma membrane H + -ATPase. IV. Fusicoccin induces the association between the plasma mem...

Ngày tải lên: 19/02/2014, 07:20

8 629 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGG CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢). Nested PCR was carried ... endo- and exo- peptidases are widespread in nature and found in viruses, archaea, bacteria and euk- aryotes. The biological importance of peptidases are clearly indicated by t...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

... 5¢-ATA CCATGGACAAAACCCACAGTACAATG P1OH 5¢- CATATGCACAAAACCCACAGTAC P2O 5¢-TAT GGATCCTTAATTAGAAACAAACTGTCTGA TAAAC P2OH 5¢- CTCGAGATTAGAAACAAACTGTCTGATAAACC P1Z 5¢-ATA CCATGGCTGGAGAAGACTTTAAGATC P1ZH ... 5¢- CATATGACTGGAGACTTTAAGATC P2Z 5¢-TAT GGATCCTCACCACCCAATTTCGGAAAG P2ZH 5¢- CTCGAGCCACCCAATTTCGGAAAGT Table 2. Over-expression plasmids for Sno1p and Snz1p prepared in this study. Symbols O...

Ngày tải lên: 19/02/2014, 12:20

8 650 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Aiba Y, Nakamura K, Namba T, Hirata M, Mazda O, Katsura Y & Narumiya S (1993) Thromboxane A2 receptor is highly expressed in mouse immature thymocytes and mediates DNA fragmentation and apoptosis. ... Ireland The prostanoid thromboxane (TX )A 2 induces activa- tion and aggregation of platelets, constriction of vascu- lar (V) and bronchial smooth muscle (SM) and of rena...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

... asso- ciated with the plasma membrane of epidermal cells. At this magnification, the vacuolar membrane and the plasma membrane could not be resolved, because the vacuole takes a large part of the ... Àðk A =k 0 Þ= A ð1Þ where k A and k 0 are the inactivation rate constants either in the presence or in the absence of various concentrations of a lig...

Ngày tải lên: 20/02/2014, 01:20

15 589 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... tubingensis (CAA68128.1), Pgx2 Arabi- dopsis thaliana (AAF21195.1). The mode of action (endo or exo) and the amount of GalpA cleaved off, respectively, are annotated in paren- theses. A question mark indicates ... of pectin are classified as members of family 28 of the glycoside hydrolases, including the endopolygalacturonases, exo- polygalacturonases and rhamnogalact...

Ngày tải lên: 20/02/2014, 03:20

10 592 0
Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

... I domain of CD1 1a, and partially but significantly inhibited the interaction between ICAM-4 L cells and CD1 1a I domain. The adhesion of all ICAM transfectants to the I domain of CD1 1a was almost ... domain GST fusion proteins migrated as major bands of  50 kDa. After Factor X or thrombin cleavage and removal of GST the I domains appeared as single major bands...

Ngày tải lên: 20/02/2014, 11:20

14 495 0
w