Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

... In Madin–Darby canine kidney (MDCK) cells, a study of chimeric forms of DPP IV has shown that the luminaldomain of DPP IV carries dominant apical sortinginformation while the short cytoplasmic tail and ... tail. Investigation here for a role of c-Src in DPP IV phosphorylation indeed reveals that notonly is c-Src associated with DPP IV, but its associ-ation is dependent of insulin with maximal ... peptidase IV activates an associated tyrosine kinase and triggers anapoptotic signal in human hepatocarcinoma cells. Hepa-tology 27, 934–942.15 Biemesderfer D, Dekan G, Aronson PS & FarquharMG...

Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

... plays a dominant role in mediating the association of tau withFyn-SH2.Tau phosphorylated at Tyr18 has been detected in a proportion of tangles in early AD brain [31], and in paired helical ... interactions of tau and Fyn may playan important role in regulating the cellular localization of Fyn and tau.ResultsTau interacts with Fyn-SH2Because tau contains tyrosines that could be targetedby ... also an increase in the amount of DRM-associated tau isolated from wild-type neurons(Fig. 5A) . In contrast, pervanadate did not appear toinduce any change in the amount of tau in the DRMfraction...

Tài liệu Báo cáo khoa học: Major phosphorylation of SF1 on adjacent Ser-Pro motifs enhances interaction with U2AF65 doc

... 12,858–867.16 Rain JC, Raﬁ Z, Rhani Z, Legrain P & Kramer A (1998) Conservation of functional domains involved in RNA binding and protein–protein interactions in human and Saccharomyces cerevisiae pre-mRNA ... 1513–1526.25 Maucuer A, Camonis JH & Sobel A (1995) Stathmininteraction with a putative kinase and coiled-coil-form-ing protein domains. Proc Natl Acad Sci USA 92, 3100–3104.26 Maucuer A, Ozon ... Chandler SD & Fu XD (1994)Puriﬁcation and characterization of a kinase speciﬁc for the serine- and arginine-rich pre-mRNA splicing factors.Proc Natl Acad Sci USA 91, 10824–10828.7 Wang...

Tài liệu Báo cáo khoa học: Single phosphorylation of Tyr304 in the cytoplasmic tail of ephrin B2 confers high-afﬁnity and bifunctional binding to both the SH2 domain of Grb4 and the PDZ domain of the PDZ-RGS3 protein ppt

... This kind of ﬂexible conformations may be morefavorable for Grb4 SH2 domain binding, as almost all SH2-binding phosphotyrosine peptides appear to assume exten-ded conformations in the binding ... Zhu for technicalassistance. We also thank Andy Ng and Evelyne Copeland for criticalreading of the manuscript. This work was supported by a Genomicsand Health Research Initiative of the National ... domain bindingmotif, PHpY304EKV, on the cytoplasmic domains of Bephrins that may be essential for reverse signaling via theGrb4 adaptor protein alone or in concert with proteinscontaining...

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... Yonezawa M, Maruyama K, Yamaguchi-Shino-zaki K & Shinozaki K (2007) The mitogen-activatedprotein kinase cascade MKK3-MPK6 is an importantpart of the jasmonate signal transduction pathway in Arabidopsis. ... Different MAPK path-ways respond to a variety of external stimuli and con-sist of three sequentially acting protein kinases: a MAPK kinase kinase, a MAPK kinase (MAPKK) andﬁnally a MAPK [19]. ... transformation of intact yeast cells. Nucleic Acids Res 20, 1425.39 Matsuoka D, Nanmori T, Sato K, Fukami Y, KikkawaU & Yasuda T (2002) Activation of AtMEK1, an Ara-bidopsis mitogen-activated...

Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

... in various organ systems. Even in organismslacking a brain, such as Caenorhabditis elegans, thenervous system plays a key role in maintaining energybalance [1–4]. In more advanced, mammalian ... decarboxylase. Role of the AMP-dependent proteinkinaseAMPK, a nutrient-sensitive kinase, plays a pivotal role in mammalian energy metabolism [25,26]. AMPK wasinitially identiﬁed as the kinase ... [41–45].There are at least six carnitine acyltransferases in mammals [46]. Carnitine acetyltransferase and carni-tine octonyltransferase mediate the transfer of acetyland short- to medium-chain fatty acyl-CoAs....

Tài liệu Báo cáo khoa học: Proteolytic processing regulates pathological accumulation in dentatorubral-pallidoluysian atrophy pdf

... theN-terminal huntingtin fragment that contains the pol-yQ tract was cleaved by caspase-3 in vitro and in thehuman brain tissues [27], and that cleavage at thecaspase-6 site in huntingtin was essential ... Haw River syndrome: dentatorubropallidoluysianatrophy (DRPLA) in an African-American family. NatGenet 7, 521–524.15 Yazawa I, Nukina N, Hashida H, Goto J, Yamada M& Kanazawa I (1995) Abnormal ... plays a principal role in the pathological accumulation of ATN1 in dentatorubral-pallidoluysianatrophy.AbbreviationsALLN, N-acetyl-Leu-Leu-norleucinal; ATN1, atrophin-1; DRPLA, dentatorubral-pallidoluysian...

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... Forward (nt 1552–1585 PAI-2)SJS260 AACTCACCATAGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2)SJS261 CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2)SJS262 AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2)SJS138 TACGAGATCTTAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2)SJS172 GGGATCATGCCCAAGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2)SJS173 AGTAAGGAAAATAAGCTTGGGCATGATCCC Reverse ... 1520–1491 PAI-2)SJS174 GCTCACTGCCTAAGCTTTGTAGCTAATAAAG Forward (nt 1596–1625 PAI-2)SJS175 CTTTATTAGCTACAAAGCTTAGGCAGTGAGC Reverse (nt 1625–1596 PAI-2)SJS259 CTTTGTTATTTATTATGCATTCCTATGGTGAGTT Forward...

Tài liệu Báo cáo khoa học : Chủ tịch Hồ Chí Minh và bản di chúc hôm nay và mai sau ppt

... dd lan nhau. Dd chfnh la ed ly, ed tinh, chan thanh, thang than, la van hoa Dang, la ban chat tam hdn va dao dQc dan tdc Viet ma Ho Chf Minh mong mdi va gQi lai eho toan Dang, toan ... "van thudc vao gia tai eua nhan loai, cai gia tai cua mgi dan tdc yeu tQ do, giai phdng da phai tien hanh dau tranh chdng lai ach thQc dan hay de qud'c"^, nham thQc hien khat ... ddng bao va chien sT ca nQde, va thay mat nhan dan Viet Nam "di tham va cam On" be ban qud'c te da "tan tinh ung hd va giup dd" cudc khang chien eua nhan dan ta....

Tài liệu Báo cáo khoa học: High-afﬁnity ligand binding by wild-type/mutant heteromeric complexes of the mannose pptx

... anunexpected decrease in PMP-BSA binding. It thusappears that tethering of the C-terminal end of theectodomain is important for both IGF-II and PMP-BSA binding. In summary, the major ﬁndings ... repeat 11containing the principal residues responsible for IGF-II binding. Theshaded rectangles indicated repeats 3 and 9, to which the maindeterminants of Man-6-P binding have been mapped and ... a ﬂattened b-barrel [16]. Ligand bindingexperiments have mapped the Man-6-P bindingdomains mainly to repeats 3 and 9, wherein mutation of critical residues can reduce ligand afﬁnity [17], andsuch...

Xem thêm