Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt
... In Madin–Darby canine kidney (MDCK) cells, a study of chimeric forms of DPP IV has shown that the luminal domain of DPP IV carries dominant apical sorting information while the short cytoplasmic tail and ... tail. Investigation here for a role of c-Src in DPP IV phosphorylation indeed reveals that not only is c-Src associated with DPP IV, but its assoc...
Ngày tải lên: 19/02/2014, 07:20
... plays a dominant role in mediating the association of tau with Fyn-SH2. Tau phosphorylated at Tyr18 has been detected in a proportion of tangles in early AD brain [31], and in paired helical ... interactions of tau and Fyn may play an important role in regulating the cellular localization of Fyn and tau. Results Tau interacts with Fyn-SH2 Because tau contains tyrosin...
Ngày tải lên: 14/02/2014, 14:20
... 12, 858–867. 16 Rain JC, Rafi Z, Rhani Z, Legrain P & Kramer A (1998) Conservation of functional domains involved in RNA binding and protein–protein interactions in human and Saccharomyces cerevisiae pre-mRNA ... 1513–1526. 25 Maucuer A, Camonis JH & Sobel A (1995) Stathmin interaction with a putative kinase and coiled-coil-form- ing protein domains. Proc Natl Acad Sci USA...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Single phosphorylation of Tyr304 in the cytoplasmic tail of ephrin B2 confers high-affinity and bifunctional binding to both the SH2 domain of Grb4 and the PDZ domain of the PDZ-RGS3 protein ppt
... This kind of flexible conformations may be more favorable for Grb4 SH2 domain binding, as almost all SH2- binding phosphotyrosine peptides appear to assume exten- ded conformations in the binding ... Zhu for technical assistance. We also thank Andy Ng and Evelyne Copeland for critical reading of the manuscript. This work was supported by a Genomics and Health Research Initiative...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... Yonezawa M, Maruyama K, Yamaguchi-Shino- zaki K & Shinozaki K (2007) The mitogen-activated protein kinase cascade MKK3-MPK6 is an important part of the jasmonate signal transduction pathway in Arabidopsis. ... Different MAPK path- ways respond to a variety of external stimuli and con- sist of three sequentially acting protein kinases: a MAPK kinase kinase, a MAPK kinase (MAP...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx
... in various organ systems. Even in organisms lacking a brain, such as Caenorhabditis elegans, the nervous system plays a key role in maintaining energy balance [1–4]. In more advanced, mammalian ... decarboxylase. Role of the AMP-dependent protein kinase AMPK, a nutrient-sensitive kinase, plays a pivotal role in mammalian energy metabolism [25,26]. AMPK was initially...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Proteolytic processing regulates pathological accumulation in dentatorubral-pallidoluysian atrophy pdf
... the N-terminal huntingtin fragment that contains the pol- yQ tract was cleaved by caspase-3 in vitro and in the human brain tissues [27], and that cleavage at the caspase-6 site in huntingtin was essential ... Haw River syndrome: dentatorubropallidoluysian atrophy (DRPLA) in an African-American family. Nat Genet 7, 521–524. 15 Yazawa I, Nukina N, Hashida H, Goto J, Yamada M & Kana...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS262 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2) SJS138 TACG AGATCT TAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2) SJS172 GGGATCATGCCCA AGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2) SJS173 AGTAAGGAAAATA AG...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học : Chủ tịch Hồ Chí Minh và bản di chúc hôm nay và mai sau ppt
... dd lan nhau. Dd chfnh la ed ly, ed tinh, chan thanh, thang than, la van hoa Dang, la ban chat tam hdn va dao dQc dan tdc Viet ma Ho Chf Minh mong mdi va gQi lai eho toan Dang, toan ... "van thudc vao gia tai eua nhan loai, cai gia tai cua mgi dan tdc yeu tQ do, giai phdng da phai tien hanh dau tranh chdng lai ach thQc dan hay de qud'c"^, nham thQc hien kha...
Ngày tải lên: 17/02/2014, 05:20
Tài liệu Báo cáo khoa học: High-affinity ligand binding by wild-type/mutant heteromeric complexes of the mannose pptx
... an unexpected decrease in PMP-BSA binding. It thus appears that tethering of the C-terminal end of the ectodomain is important for both IGF-II and PMP- BSA binding. In summary, the major findings ... repeat 11 containing the principal residues responsible for IGF-II binding. The shaded rectangles indicated repeats 3 and 9, to which the main determinants of Man-6-P binding have be...
Ngày tải lên: 18/02/2014, 08:20