Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf
... antibody on formalin-fixed and paraffin-embedded tissues (Fig. 9). Antibodies against PCNA and Cdc45 stained malignant cells in a compar- able manner, e.g. on invasive-lobular mamma carci- noma sections ... in histological material is a valuable component of conventional histopathologi- cal analysis and may be of major prognostic import- ance [56]. Proliferation in immunohistochemical s...
Ngày tải lên: 19/02/2014, 00:20
... Hill Road Palo Alto, CA 94304, USA mforst@parc.com Abstract In this paper we present a human- based evaluation of surface realisation alterna- tives. We examine the relative rankings of naturally ... European Chapter of the ACL, pages 112–120, Athens, Greece, 30 March – 3 April 2009. c 2009 Association for Computational Linguistics Human Evaluation of a German Surface Realisation Rank...
Ngày tải lên: 22/02/2014, 02:20
... substrate for caspase 1; Ac-IETD-AMC is a substrate for caspase 8 and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, 5 and 9. Ac-DVPD-AMC, Ac-DPSD-AMC and Ac-ESQD-AMC are tetra peptide substrates representing ... follows: caspase 1, WEHD-AMC; caspase 2, VDVAD- AMC; caspase 3, DEVD-AMC; caspase 4, WEHD-AMC; caspase 5, WEHD-AMC, caspase 6, VEID-AMC; caspase 7, DEVD-AMC; ca- spase 8,...
Ngày tải lên: 19/02/2014, 13:20
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt
... TAT ATG T Weak 3 aa 2 ⁄ 4 55067 TCA ATG C Weak 58 aa 3 33 39% 60929 60933 60939 GTA ATG C TGC ATG T TCC ATG G G Adequate Weak Adequate 13 aa 33 aa 31 aa 3¢ 76 49% – 4¢ 56 61% 61041 GGA ATG T Adequate ... [13]. Position Kozak consensus A GCC ATG G G Context ATG 1 330 AAG ATG A Adequate ATG 2 345 CTG ATG T Weak ATG 3 396 CCC ATG A Weak ATG 4 489 CTG ATG A Weak Hu-K4 A. Munck et al. 172...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: "Acquiring Receptive Morphology: A Connectionist Model" pdf
... a partic- ular template. The present template was ClaC2aCaa, the past template aCtC2aaC3, and the future template aClaC2Caa. Thus the three forms for the root pmn were pamana, apmaan, ... following two template morphology rules, involving three forms: (1) present: CzaC2aCaa, past: aCiC2aaC3, future: aClaC2C 3a (2) present: ClaC2Caaa, past: aC1C2aCaa, future: aClaC3aC2...
Ngày tải lên: 20/02/2014, 21:20
Tài liệu Báo cáo khoa học: "GRADED UNIFICATION: INTERACTIVE A FRAMEWORK PROCESSING" pdf
... van, which is inanimate, makes a good Theme but a poor Agent for recognized, the past participial analysis in 2) is reinforced and the main clause (past tense) sup- pressed. Being animate, ... combinatory mechanism in classical constraint-based parsers, is too brittle to withstand this onslaught of uncertainty. This paper presents an extension to classical unifi- cation,...
Ngày tải lên: 20/02/2014, 21:20
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2 ⁄ PDIP46 ⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT pYESTrp2 ⁄ PDIP46 ⁄ SKAR(G) ... SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATC...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Human intrinsic factor expressed in the plant Arabidopsis thaliana doc
... potential as a large-scale source of human IF for analytical and therapeutic purposes. Keywords: arabidopsis; cobalamin; intrinsic factor; recom- binant. Vitamin B 12 (cobalamin, Cbl) is the ... recombinant plants for large-scale production of pathogen-free human recombinant IF. Human IF was successfully expressed in the recombinant plant Arabidopsis thaliana. Extract from fresh pla...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx
... Kagara I, Matsuda R, Toki K, Nishimura H, Chiyomaru T, Tatarano S, Ide- sako T et al. (2007) Nuclear translocation of ADAM- 10 contributes to the pathogenesis and progression of human prostate ... bovine brain myelin membrane preparations [1], and was referred to as MADM (i.e. mammalian disintegrin-me- talloprotease). Accidentally, this metalloproteinase was identified via an artifact result...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... CBP is a structural platform that is capable of binding several different families of transcriptional activators [30], and evidence indicates that the KIX domain has the ability to simultaneously ... general transcriptional co-activators that contain histone and transcription factor acetylation activities [30]. In addi- tion, CBP contains a number of protein-binding domains that media...
Ngày tải lên: 16/02/2014, 14:20