Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt

... formation of the M4 a cluster prior to formation of the M3b cluster, demonstrating that the individual binding constants of divalent metal ions for the a domain are larger than those for the b domain. Further ... elucidate the potentially cooper-ative nature of the metal- binding reaction within each of the domains. Thus, the goal is to elucidate the meta-llation mechanisms of the individual domains, in the hope, ... noncoop-erative metal binding is predicted to result in the for- mation of intermediate, partially metallated, species,alaalaalaalalysglymetsergly A M4(Scys)11 Domain of Recombinant Human...

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... AlaL6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg Arg37 and Arg40 to Asn3K > Q K64Q F caggacagtctgcagcaggttgaacaagcgagcctcac ... to AlaL2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg Leu25 to AlaG3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to AlaF3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg Phe39 to Ala3K > Q K37Q ... Leu18 to GlyF2 0A F2 0A F catcgttgtactgcttgctggcaccaaaaagctc Phe20 to AlaG2 1A G2 1A F gttgtactgctttttgccaccaaaaagctcgg Gly21 to AlaK2 4A K2 4A F gctttttggcaccaaagccctcggctccatcgg Lys24 to AlaL25A...

Tài liệu Báo cáo khoa học: Evidence for proteasome dysfunction in cytotoxicity mediated by anti-Ras intracellular antibodies pdf

... percentage of G418-resistant colonies obtained by transfecting the established human tumor pancreatic carcinoma MIA PaCa 2 and the breast adenocarcinoma MDA-MB-231 cells with the anti-(Ras 1) and anti-(Ras ... from the total cellularenvironment to the huntingtin aggregates and to a higherrate of aggresome formation. Consequently, there is a decrease in proteasome availability for degrading otherkey ... related to the aggregation state of the scFvfragments, irrespective of the binding afﬁnity and p21Rasepitope recognized by the scFv. Thus, the binding afﬁnity of the aggregating scFv fragments...

Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt

... years as a result of the expansion of the Aedes aegypti mosquito to dif-ferent geographic areas, and DHF has spread fromSouth East Asia to the Western Paciﬁc and the Americas. A substantial ... NJ, Yao N, Wright-Minogue J, Zhang R,Ramanathan L, Lau JY, Hong Z & Dasmahapatra B(2000) Hepatitis C NS3 protease: restoration of NS 4A cofactor activity by N-biotinylation of mutated NS 4A using ... of themincluding the immunodominant cytotoxic epitopes of the others [63]. The major pharmaceutical companies are currentlydeveloping a treatment against the disease. A tetra-valent live attenuated...

Tài liệu Báo cáo khoa học: Fermentative lifestyle in yeasts belonging to the Saccharomyces complex ppt

... duplication took place after the separation of Saccharomyces, Kazachstania, Naumovia, Nakesimiaand Tetrapisispora from the rest of Saccharomycescomplex genera (Fig. 1).Another problem for comparative ... due to amino acid biosynthesis. Much of the generation of NADH during amino acid biosyn-thesis takes place in the mitochondria. Because of the block in the respiratory chain caused by the addition of ... newgenera Lachancea, Nakaseomyces, Naumovia, Vanderw-altozyma and Zygotorulaspora. FEMS Yeast Res 4,233–245.29 Wolfe KH & Shields DC (1997) Molecular evidence for an ancient duplication of the...

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... were used for the preparation and ligation of DNA fragments, for the trans-formation of Escherichia coli and for the isolation of plas-mid DNA from bacterial cells [51]. Other yeast geneticmethods ... 500 kDaband to the 670 kDa band, a structural rearrangement of the bc1complex may occur due to the binding of ISPand Qcr10p, possibly leading to the dimerization of the complex. Such a structural ... Cleavage of structural proteinsduring the assembly of the head of bacteriophage T4.Nature 227, 680–685.49 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities...

Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt

... some of the a- amylase family CSRs, namely the b-strandsb2, b3, b4 and b8 of the (b ⁄ a) 8barrel domain, and for rBAT also with the short stretch near the C-terminus of domain B [9,19]. From the ... lizards and frogs (lacking both essential aspar-tates at the b4- and b7-strands) and also from someﬁshes (lacking the b4-strand aspartate). This may meanthat the eventuality of a- glucosidase ... withinwhich taxonomy is respected: (a) for the rBATs from human via representatives of mammals, birds, lizard,frogs and ﬁshes to Urochordata (sea squirts) andCephalochordata (lancelet); and (b) for the...

Tài liệu Báo cáo khoa học: Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells docx

... was used for RT-PCR. PCR ampliﬁcation of cDNAs was per-formed with the following primers: 5¢-TCTCTGCTGCCAGACA-3¢ and 5¢-GCCACAGCAGAACAGA-3¢ for HVEM; 5¢-TCCTTCACCGATGGCACTATCC-3¢ and5¢-TCAACACCAGCAGGATGCTC-3¢ ... and5¢-TCAACACCAGCAGGATGCTC-3¢ for nectin-1; and5¢-AGAAGCAGCAGCACCAGCAG-3¢ and 5¢-GTCACGTTCAGCCAGGA-3¢ for nectin-2. The 3-OST-3 sequenceswere ampliﬁed using 5¢-CAGGCCATCATCATCGG-3¢and 5¢ -CCGGTCATCTGGTAGAA-3¢ ... (Molecular Devices) was used to measureb-galactosidase activity at 410 nm.Statistical analysisData are expressed as mean ± SD and were analyzedstatistically by using one-way ANOVA tests....

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... phosphatase catalytic domains; black dots, protease cleavage sites. (B) SDS ⁄ PAGEseparation of FN3d–AP puriﬁed from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose. ... pre-viously characterized PTPr interactor.Nucleolin was ﬁrst described as a major nuclear pro-tein consisting of a negatively charged N-terminal domain, an RNA -binding domain and a C-terminal domain ... identify the extracellular ligands of the RPTPs in the neuromuscular system. For example, it is knownthat PTPd and an isoform of LAR can interacthomophilically [39] and that LAR can also bindheterophilically...

Tài liệu Báo cáo khoa học: Enzymes for the NADPH-dependent reduction of dihydroxyacetone and D-glyceraldehyde and L-glyceraldehyde in the mould Hypocrea jecorina doc

... used: 5¢-gaattcagaatggcctccaagacgta-3¢ and 5¢-gaattcttattcctcctctggccaaa-3¢. The PCR product was cloned, similar to gld1, ﬁrst in a TOPOvector and then in the expression vector p2159. The S. cere-visiae ... by the Maj and Tor Nes-sling Foundation and PR was an Academy ResearchFellow of the Academy of Finland.References1 Baliga BS, Bhatnagar GM & Jagannathan V (1964)Nicotinamide adenine ... l-Glyceraldehyde wassuggested to be generated in the catabolic pathway for d-galacturonate (Kuorelahti et al., unpublishedresults). In these pathways, the sugar acids d-gluco-nate, d-galactonate and...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị nghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vv báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien tai lieu bao cao thuc tap y si da khoa báo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptx tai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinh báo cáo khoa học về nghệ thuật trong lieu trai chi di tai lieu bao cao thuc tap tai khoa duoc benh vien hop luc đề tài báo cáo khoa học Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Chuong 2 nhận dạng rui ro Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ