Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt

... formation of the M 4 a cluster prior to formation of the M 3 b cluster, demonstrating that the individual binding constants of divalent metal ions for the a domain are larger than those for the b domain. Further ... elucidate the potentially cooper- ative nature of the metal- binding reaction within each of the domains. Thus, the goal is to e...

Ngày tải lên: 19/02/2014, 00:20

... Ala L6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala 2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg Arg37 and Arg40 to Asn 3K > Q K64Q F caggacagtctgcagcaggttgaacaagcgagcctcac ... to Ala L2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg Leu25 to Ala G3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to Ala F3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg...

Ngày tải lên: 19/02/2014, 17:20

... percentage of G418- resistant colonies obtained by transfecting the established human tumor pancreatic carcinoma MIA PaCa 2 and the breast adenocarcinoma MDA-MB-231 cells with the anti-(Ras 1) and anti-(Ras ... from the total cellular environment to the huntingtin aggregates and to a higher rate of aggresome formation. Consequently, there is a decrease in proteasome av...

Ngày tải lên: 21/02/2014, 00:20

... years as a result of the expansion of the Aedes aegypti mosquito to dif- ferent geographic areas, and DHF has spread from South East Asia to the Western Pacific and the Americas. A substantial ... NJ, Yao N, Wright-Minogue J, Zhang R, Ramanathan L, Lau JY, Hong Z & Dasmahapatra B (2000) Hepatitis C NS3 protease: restoration of NS 4A cofactor activity by N-biotinylati...

Ngày tải lên: 19/02/2014, 00:20

... duplication took place after the separation of Saccharomyces, Kazachstania, Naumovia, Nakesimia and Tetrapisispora from the rest of Saccharomyces complex genera (Fig. 1). Another problem for comparative ... due to amino acid biosynthesis. Much of the generation of NADH during amino acid biosyn- thesis takes place in the mitochondria. Because of the block in the respi...

Ngày tải lên: 19/02/2014, 02:20

... were used for the preparation and ligation of DNA fragments, for the trans- formation of Escherichia coli and for the isolation of plas- mid DNA from bacterial cells [51]. Other yeast genetic methods ... 500 kDa band to the 670 kDa band, a structural rearrangement of the bc 1 complex may occur due to the binding of ISP and Qcr10p, possibly leading to the...

Ngày tải lên: 18/02/2014, 08:20

... some of the a- amylase family CSRs, namely the b-strands b2, b3, b4 and b8 of the (b ⁄ a) 8 barrel domain, and for rBAT also with the short stretch near the C-terminus of domain B [9,19]. From the ... lizards and frogs (lacking both essential aspar- tates at the b4- and b7-strands) and also from some fishes (lacking the b4-strand aspartate). This may mean that th...

Ngày tải lên: 18/02/2014, 13:20

... was used for RT-PCR. PCR amplification of cDNAs was per- formed with the following primers: 5¢-TCTCTGCTGC CAGACA-3¢ and 5¢-GCCACAGCAGAACAGA-3¢ for HVEM; 5¢-TCCTTCACCGATGGCACTATCC-3¢ and 5¢-TCAACACCAGCAGGATGCTC-3¢ ... and 5¢-TCAACACCAGCAGGATGCTC-3¢ for nectin-1; and 5¢-AGAAGCAGCAGCACCAGCAG-3¢ and 5¢-GTCACG TTCAGCCAGGA-3¢ for nectin-2. The 3-OST-3 sequences were amplified using 5¢-C...

Ngày tải lên: 18/02/2014, 14:20

... phosphatase catalytic domains; black dots, protease cleavage sites. (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose. ... pre- viously characterized PTPr interactor. Nucleolin was first described as a major nuclear pro- tein consisting of a negatively charged N-terminal domain, an RNA -binding domain and a...

Ngày tải lên: 19/02/2014, 05:20

... used: 5¢-gaattcagaatg gcctccaagacgta-3¢ and 5¢-gaattcttattcctcctctggccaaa-3¢. The PCR product was cloned, similar to gld1, first in a TOPO vector and then in the expression vector p2159. The S. cere- visiae ... by the Maj and Tor Nes- sling Foundation and PR was an Academy Research Fellow of the Academy of Finland. References 1 Baliga BS, Bhatnagar GM & Jagannathan V (196...

Ngày tải lên: 19/02/2014, 06:20