Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

... and appears to be much moreresistant to proteasomal degradation than Rac1L61. Mutational analysis ofall lysine residues in Rac1 revealed that the major target site for Rac1ubiquitination is ... Indeed, in Rac2 and Rac3, whichare resistant to proteasomal degradation, Lys1 47 is either absent (Rac3), or is in a different environment ascompared to Rac1 (Rac2). Lys1 47 is not conservedamong Rho ... resistant to proteasomal degradation. We show bymutational analysis that the main target site forRac1L61 polyubiquitination is Lys1 47, a surface resi-due that should not be hampered in Rac1b;...

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx

... Schapira AH (2008) Mitochondria in the aetiology andpathogenesis of Parkinson’s disease. Lancet Neurol 7,97–109.4 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Sai-to M, Maruyama M, Takahashi ... stress conditions. Speciﬁcally, this association is mediated by pathogenic DJ-1 mutations and oxidativestress [76]. These data suggest a link DJ-1 and Parkin in a common pathway in mammals. A described ... LRRK2 and ATP1 3A2 cause autosomal-dominant forms of parkinsonism.Mutations in the genes encoding Parkin, DJ-1 andPINK1 all cause autosomal-recessive parkinsonism ofearly onset and are the focus...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... NA TGCARRAAYATHTTYTCCAGDeg RPE65-Rev AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011) ... CTGAGGTTACAGACAACTGTTC13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653...

Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc

... cleavage via the mitochondrial pathway [47]. Caspase-9 is alsocleaved by caspase-3 at another cleavage site. How-ever, this fragmentation does not have caspase activity.It enhances the activation ... 28549–28552.53 Sakahira H, Enari M & Nagata S (1998) Cleavage ofCAD inhibitor in CAD activation and DNA degrada-tion during apoptosis. Nature 391, 96–99.54 Agarwal A, Mahfouz RZ, Sharma RK, Sarkar ... oligonu-cleosomal DNA fragmentation [14].In addition, caspases are a key mediator of DNAfragmentation. Caspases activate most apoptotic path-ways through the cleavage of a wide range of cytoplas-mic and...

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAAGTTAGAACT-3¢Reverse: 5¢-TAGCGGCCGCTTACTTTGGGTTAACGACGGA-3¢Mutant MPHbG194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢G198P 5¢-AAAGGTTTCTTCAAGCCGGCCATGGCTTCCCTT-3¢G194P ... can adopt only a few conﬁgurations and has the lowest conformational entropy [19,20]. A glycine toproline mutation could therefore decrease the confor-mational entropy of a protein and lead ... Ochr-MPH was calculated at the nanosecond timescale, and an eight-amino acidloop region (residues 186–193) was identiﬁed as having high conforma-tional ﬂuctuation. The two glycines nearest to this...

Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf

... that upon peptide binding, NarJundergoes a conformational change. Isothermal titra-tion calorimetry (ITC) and BIAcore analysis showedthat protonation of the chaperone is responsible for a ... mostly via hydrophobic interactions as deduced fromisothermal titration calorimetry analysis. NMR and differential scanningcalorimetry analysis revealed a modiﬁcation of NarJ conformation duringcomplex ... character of the binding process predicted by ITC data.BIAcore surface plasmon resonance was used toinvestigate the kinetic parameters of the interaction (on rate constant k on and off rate...

Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

... inhibit a linkedactivation domain, and this inhibition is not limited to the Meis2 activationdomain. Database searching reveals that the Meis3.2 splice variant, which is found in several vertebrate ... suggesting that the approximately 150 amino acids C-terminal to the HDof Meis2d contain a transcriptional AD.Both the Meis2 AD and the Hth domain arerequired for transcriptional activation byMeis–PbxTo ... interactions, allowingaccess to the AD. As the autoinhibition affected anunrelated AD when this was put in place of the nativeMeis2d AD, it appears that any intramolecular interac-tions with the Hth...

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

... is the restriction of motion along the acyl chains once the lipids have packed around the protein. Because this behavior arises as a result of the tilt of the peptide and interactions between the embedded ... neuriticplaques observed in the brains of Alzheimer’s patients.Because Ab is localized in the plasma membrane,an analysis of the interactions between the peptideand the membrane environment is crucial ... in the USA alone, the molecular basis for this disease is a topic of intense scientiﬁc research.According to the ‘amyloid hypothesis’, interactionsbetween the amyloid b-peptide (Ab) and other...

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

... maturation but at the same timean unaltered conformational distribution of the N-ter-minal tail and a normal response to TF.DiscussionFVIIa contains the canonical activation domain char-acteristic ... supporting the active conformation. One bond participates in stabil-ization of the 170 loop while the other connects activa-tion loops 2 and 3. Weakening or abrogation of the former bond, as in G37 2A- FVIIa, ... of the protease domain in the activation pocket of the activation domain [15]. Thisevent is (part of) the mechanism that TF employs tostimulate FVIIa [4,18]. Amino acid changes at a fewother...

Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

... [4–7]. The major drawback of these analyses is the lack ofinformation regarding the activity or loss of activityof the target protein, as only a few variants (< 100)have been fully analysed. ... there is 75% probability for the mutation to be nonsevere if the energy is 0.125 or lower. Thus, on the basis of thisvariable alone, we can make reasonably accurate pre-dictions on 35% of the ... the 1% value, the data were always harder to separate (seeTable 3). In the case of the 1% limit, the distributionbetween the two classes is highly skewed. A predictionstating that all mutations...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP