Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

... and appears to be much more resistant to proteasomal degradation than Rac1L61. Mutational analysis of all lysine residues in Rac1 revealed that the major target site for Rac1 ubiquitination is ... Indeed, in Rac2 and Rac3, which are resistant to proteasomal degradation, Lys1 47 is either absent (Rac3), or is in a different environment as compared to Rac1 (Rac2). Lys1 47 is not...

Ngày tải lên: 18/02/2014, 16:20

11 470 0
Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx

... Schapira AH (2008) Mitochondria in the aetiology and pathogenesis of Parkinson’s disease. Lancet Neurol 7, 97–109. 4 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Sai- to M, Maruyama M, Takahashi ... stress conditions. Specifically, this association is mediated by pathogenic DJ-1 mutations and oxidative stress [76]. These data suggest a link DJ-1 and Parkin in a common pathway in mam...

Ngày tải lên: 18/02/2014, 14:20

9 776 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... NA TGCARRAAYATHTTYTCCAG Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev ... GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi et al. A no...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc

Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc

... cleavage via the mitochondrial pathway [47]. Caspase-9 is also cleaved by caspase-3 at another cleavage site. How- ever, this fragmentation does not have caspase activity. It enhances the activation ... 28549–28552. 53 Sakahira H, Enari M & Nagata S (1998) Cleavage of CAD inhibitor in CAD activation and DNA degrada- tion during apoptosis. Nature 391, 96–99. 54 Agarwal A, Mahfouz...

Ngày tải lên: 14/02/2014, 22:20

15 784 0
Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ Mutant MPH b G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ G198P 5¢-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3¢ G194P ... can adopt only a few configurations and has the lowest conformational entropy [19,20]. A glycine to proline mutation could therefore decrease the confor- mational entrop...

Ngày tải lên: 15/02/2014, 01:20

8 740 0
Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf

Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf

... that upon peptide binding, NarJ undergoes a conformational change. Isothermal titra- tion calorimetry (ITC) and BIAcore analysis showed that protonation of the chaperone is responsible for a ... mostly via hydrophobic interactions as deduced from isothermal titration calorimetry analysis. NMR and differential scanning calorimetry analysis revealed a modification of NarJ conformation...

Ngày tải lên: 16/02/2014, 14:20

10 685 0
Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

... inhibit a linked activation domain, and this inhibition is not limited to the Meis2 activation domain. Database searching reveals that the Meis3.2 splice variant, which is found in several vertebrate ... suggesting that the approximately 150 amino acids C-terminal to the HD of Meis2d contain a transcriptional AD. Both the Meis2 AD and the Hth domain are required for tra...

Ngày tải lên: 16/02/2014, 15:20

14 753 0
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

... is the restriction of motion along the acyl chains once the lipids have packed around the protein. Because this behavior arises as a result of the tilt of the peptide and interactions between the embedded ... neuritic plaques observed in the brains of Alzheimer’s patients. Because Ab is localized in the plasma membrane, an analysis of the interactions between the p...

Ngày tải lên: 18/02/2014, 08:20

16 475 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

... maturation but at the same time an unaltered conformational distribution of the N-ter- minal tail and a normal response to TF. Discussion FVIIa contains the canonical activation domain char- acteristic ... supporting the active conformation. One bond participates in stabil- ization of the 170 loop while the other connects activa- tion loops 2 and 3. Weakening or abrogation of...

Ngày tải lên: 18/02/2014, 08:20

11 619 0
Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

... [4–7]. The major drawback of these analyses is the lack of information regarding the activity or loss of activity of the target protein, as only a few variants (< 100) have been fully analysed. ... there is 75% probability for the mutation to be nonsevere if the energy is 0.125 or lower. Thus, on the basis of this variable alone, we can make reasonably accurate pre-...

Ngày tải lên: 18/02/2014, 11:20

14 562 0
Từ khóa:
w