Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin 1 , Martin Welin 2, *, Liya Wang 1 and Staffan Eriksson 1 1 Department of Anatomy, ... in GTP activation. F133 was mutated to Asn in an attempt to create a GTP-activated enzyme, and F13 3A was prepared and tested as a control. Neither...

Ngày tải lên: 18/02/2014, 16:20

... PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional analysis, and X-ray crystallography. Biochemistry ... HPRT and several bacterial and protozoan HPRTs have been undertaken [1 3–1 7]. The structure of human HPRT can be divided into two domains: a core domain and a...

Ngày tải lên: 15/02/2014, 01:20

... 50 and near 100%) [63,77]. At this point, the data suggest that K eq A and the associated k on and k off conforma- tional rates are primary factors in regulating the cyto- chrome c reductase activity ... done to obtain measures of K eq A and the associated k 1 and k 2 values for dual-flavin enzymes, particularly when they are poised in all catalytically relevant intermediate re...

Ngày tải lên: 18/02/2014, 11:20

... used in place of MR. NADH 4 and NADPH 4 are prepared by maintaining a slight pressure ($1.2 bar) of hydrogen (> 99%) over a solution of NAD(P)H (500 mg) and palladium-activated charcoal (30 mg) ... substrate-binding titrations and crystallo- graphic studies when a very large amount of the sub- strate may be required; typical NAD(P)H saturation constants for OYEs are 0.1...

Ngày tải lên: 18/02/2014, 11:20

... cysteines located in both of the large PSI subunits, PsaA and PsaB, via a loop that also plays a role in the attachment of PsaC [12]. PsaC, PsaD and PsaE are located at the cytosolic site (Fig. 1A) [2,7,1 3–1 6]. ... M, Aoki S, Sato D, Kobayashi T, Kita K, Horii T & Hase T (2007) Cloning and characterization of ferredoxin and ferredoxin–NADP + reductase from human mala...

Ngày tải lên: 18/02/2014, 11:20

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites of ... The core of the pro- tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 Structure of Salmonella typhimurium Su...

Ngày tải lên: 18/02/2014, 14:20

... sites using a forward oligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence ... chain and hides a large amount of the hydrophobic surface area. Surface area calculations for the pentamer give a total surface area of  81 000 A ˚ 2 with 30%...

Ngày tải lên: 19/02/2014, 06:20

... revealing a remarkable increase in contact between the prostate carcinoma cells and the stromal cells, which is critical for prostate cancer progression and metastases [66]. As human prostate cancer ... S & Chott A (2000) Platelet-derived growth factor-AA and – alpha receptor expression suggests an autocrine and ⁄ or para- crine loop in osteosarcoma. Mod Pathol 13, 63 2–6...

Ngày tải lên: 19/02/2014, 07:20

... the cloning and functional characterization of an AK gene from a genomic library of L. donovani as well as its expression and molecular characterization. Materials and methods Materials Plasmids pGEM-3Zf(+) ... Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani He ´ ctor Villa 1 , Yolanda Pe ´ rez-Pertejo 1 , Carlos Garcı ´ a-...

Ngày tải lên: 21/02/2014, 00:20

... (5¢- GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7 (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢- AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA GATAC-3¢) (Fig. 1C). ... (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2 sense (5¢-CAGCAAAATGGAAAAT...

Ngày tải lên: 21/02/2014, 03:20