... administration
increased Q279E a- galactosidase A residual activity in
patient derived cells; thus, galactose was demonstrated
to be first active-site-directed pharmacologic chaperone
for a lysosomal storage disease. ... MINIREVIEW
Pharmacologic chaperoning as a strategy to treat Gaucher
disease
Zhanqian Yu, Anu R. Sawkar and Jeffery W. Kelly
Department of Chemistry...
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) for amplification of pyk. The resulting ... (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4
(5¢-CTAGTC...
... new
genera Lachancea, Nakaseomyces, Naumovia, Vanderw-
altozyma and Zygotorulaspora. FEMS Yeast Res 4,
233–245.
29 Wolfe KH & Shields DC (1997) Molecular evidence
for an ancient duplication ... kluyveri (Table 1) [36]. A similar situation was detec-
ted in species belonging to the Hanseniaspora genus.
Hanseniaspora vinae and Hanseniaspora occidentalis did
in fact exhibit the ability...
... stabilities. Remarkably, we
have found that, at least in some circumstances, a quanti-
tative correlation to biophysical data can be obtained from
a statistical analysis of selected phage populations ... the association of the variable heavy chain (V
H
)with
protein A was used as a surrogate for direct stability
measurements. The V
H
domains in camelid heavy chain
antibodies are m...
... to be false. Actions have a number of param-
eters, as well as a precondition and effect, both of
which are logical formulas. When a planner tries to
apply an action, it will first create an action ... communicative goals
as flaws that the plan must remedy. To this end,
we add an atom cg(P ,a
1
, ,a
n
) for each element
P (a
1
, ,a
n
) of the communicative goal to the in...
... The data were analysed with a window of five
wavenumbers, assuming that adjacent wavenumbers are
highly corr elated. A population o f 3 2 solutions was built at
each generation, and e valuated. ... cells a d ecrease
of the absorptions assigned to fatty a cids and phospholipids
relative to their protein content. This qua ntitative change
was accompanied by qualitative modification,...
... generation of contrastive
accent and propose an alternative method
that is feasible and computationally at-
tractive in data -to- speech systems.
1 Motivation
The placement of pitch accent plays ... should
have a contrastive accent, because the two teams
Ajax and PSV are obviously in each other's altern-
ative set. In fact, though, there is no contrast and
PSV should be normal...
... members of the ADAM family have been shown
to act as a- secretase [8,36,37]: ADAM9, ADAM10 and
ADAM17 (TACE). Overexpression of ADAM9 has
been reported to increase the basal and protein kinase
C (PKC) ... mecha-
nism: ADAM9 has been shown to proteolytically pro-
cess ADAM10 [40–42]. By contrast to ADAM9,
ADAM10 was found to have constitutive and regu-
lated a- secretase activity...
... Milne TA, Copeland
TD, Levine SS, Lee JC, Hayes DN, Shanmugam KS,
Bhattacharjee A, Biondi CA et al. (2004) Menin
associates with a trithorax family histone methyltrans-
ferase complex and with ... general
transcriptional co-activators that contain histone and
transcription factor acetylation activities [30]. In addi-
tion, CBP contains a number of protein-binding
domains that mediate tra...
... rhodanese
was also decreased by bacitracin. The decrease in the
noncatalyzed rate (31%) was similar to that of the
PDI-catalyzed reaction (a 32% decrease). These results
Fig. 1. Bacitracin has minimal ... showing a greater effect
(29% decrease in aggregation rate) than PDI (18%
decrease in rate). When 1mm bacitracin was added to
the PDI-catalyzed reaction the rate of aggregation of
rho...