Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

... examination of the articular cartilage after experimentally induced OA Articular cartilage of the femoral condyles from the experimental joints was examined to assess any macro- scopic damage ... resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage J W. Seol 1 , H B. Lee 1...

Ngày tải lên: 18/02/2014, 14:20

11 461 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

... site at an appropriate distance above the cell surface [3], and induces alloste- ric stimulation of FVIIa [4], all of which contribute to a dramatic enhancement of factor IX and X (FX) activation. Free ... precisely, an Fig. 4. N-terminal pegylation of G37 2A- FVIIa and FVIIa. (A) Pegyla- tion of free and TF-bound G37 2A- FVIIa and FVIIa visualized by SDS–PAGE. At each time poin...

Ngày tải lên: 18/02/2014, 08:20

11 619 0
Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

... mori: characterization and immunohistochemistry. Mol Cell Endocrinol 51, 22 7– 235. 41 Nagata K, Maruyama K, Nagasawa H, Urushibata I, Isogai A, Ishizaki H & Suzuki A (1992) Bombyxin-II and its ... sequence tag database on kaikoblast (http://kaikoblast.dna.affrc.go.jp/) revealed five cDNA clones that encoded an identical peptide sequence composed of a putative 20 amino acid signa...

Ngày tải lên: 18/02/2014, 13:20

12 707 0
Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants doc

Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants doc

... between arginine and canavanine for aminoacylation of the plant tRNA transcript was observed when using [ 14 C]-canava- nine. At 0.4 mm canavanine, less than 10% of the tRNA was aminoacylated compared ... further decrease the stability of the canavany- lated species. The role of tRNA as a cofactor for aminoacylation in those aminoacyl-tRNA synthetases that require tRNA for amino aci...

Ngày tải lên: 18/02/2014, 13:20

12 560 0
Tài liệu Báo cáo khoa học: Hypoxia downregulates farnesoid X receptor via a hypoxia-inducible factor-independent but p38 mitogen-activated protein kinase-dependent pathway doc

Tài liệu Báo cáo khoa học: Hypoxia downregulates farnesoid X receptor via a hypoxia-inducible factor-independent but p38 mitogen-activated protein kinase-dependent pathway doc

... Kashimura 1 , Toshihiro Akita 1 , Susumu Saitou 1 , Takehisa Atsumi 1 , Takashi Sato 1 , Ken Ando 1 , Shuntaro Hara 2 , Kiyomi Kikugawa 1 and Makio Hayakawa 1 1 School of Pharmacy, Tokyo University of ... Pharmacy and Life Science, Japan 2 School of Pharmaceutical Sciences, Showa University, Tokyo, Japan Nuclear receptors (NRs) are ligand-activated transcrip- tional factors that belong...

Ngày tải lên: 18/02/2014, 13:20

14 414 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

... CGATTTGCTGACCACCTTCT MLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATC MLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAA MLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTG MLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTG HOXC13-ERE1 ... TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACC ERa antisense CATGGTCATGGTCAG a ERb antisense GAATGTCATAGCTGA a MLL1 antisense TGCCAGTCGTTCCTCTCCAC a MLL2 antisense ACTC...

Ngày tải lên: 18/02/2014, 14:20

12 519 0
Tài liệu Báo cáo khoa học: Calcium-binding to lens bB2- and bA3-crystallins suggests that all b-crystallins are calcium-binding proteins pptx

Tài liệu Báo cáo khoa học: Calcium-binding to lens bB2- and bA3-crystallins suggests that all b-crystallins are calcium-binding proteins pptx

... molecular structure and stability of the eye lens: x-ray analysis of gamma-crystallin II. Nature 289, 77 1–7 77. 43 Delamere NA & Paterson CA (1981) Hypocalcaemic cataract. In Mechanisms of Cataract Formation ... (Stains-all). J Biol Chem 260, 598 5–5 990. 30 Sharma Y, Rao CM, Rao SC, Krishna AG, Somasundaram T & Balasubramanian D (1989) Binding site conformation dictates th...

Ngày tải lên: 18/02/2014, 16:20

13 450 0
Tài liệu Báo cáo khoa học: Chemical approaches to mapping the function of post-translational modifications ppt

Tài liệu Báo cáo khoa học: Chemical approaches to mapping the function of post-translational modifications ppt

... vivo evolution of a tRNA synthetase–tRNA pair from Methanococcus jannaschii capable of accepting and loading glycosylated amino acids has allowed the introduction of O-b-d-GlcNAc-l-Ser [25] and O -a- d-GalNAc-l-Thr ... ligation. Particularly striking was the broad substrate tolerance that could be engineered (e.g. towards non-natural amino acids) by appropriate incorporation of the...

Ngày tải lên: 18/02/2014, 17:20

11 682 1
Tài liệu Báo cáo khoa học: Bacterial-induced hepoxilin A3 secretion as a pro-inflammatory mediator pptx

Tài liệu Báo cáo khoa học: Bacterial-induced hepoxilin A3 secretion as a pro-inflammatory mediator pptx

... recruits an ADP-ribosylation factor 6 guanine nucleotide exchange factor (such as ARNO) to the apical plasma mem- brane. ARNO facilitates ADP-ribosylation factor 6 activation at the apical membrane, ... dis- ease because 12-LOX activity is induced at active sites of this disease. Because HXA 3 may play an important step underly- ing the pathophysiology of inflammatory diseases, such as i...

Ngày tải lên: 19/02/2014, 02:20

6 524 0
w