0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

... examination of the articular cartilage after experimentally inducedOA Articular cartilage of the femoral condyles from theexperimental joints was examined to assess any macro-scopic damage ... resistance to articular chondrocyte apoptosis a possible mechanism of maintaining homeostasis of normal articular cartilage J W. Seol1, H B. Lee1, Y J. Lee1, Y H. Lee2, H s. Kang1, I ... protein A BFig. 1. Evaluation of articular cartilage after experimentally inducedosteoarthritis. (A) Photomicrographs of articular cartilage. (B) Theevaluation of osteoarthritis in the right and...
  • 11
  • 461
  • 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

... site at an appropriatedistance above the cell surface [3], and induces alloste-ric stimulation of FVIIa [4], all of which contribute to a dramatic enhancement of factor IX and X (FX)activation.Free ... precisely, anFig. 4. N-terminal pegylation of G37 2A- FVIIa and FVIIa. (A) Pegyla-tion of free and TF-bound G37 2A- FVIIa and FVIIa visualized bySDS–PAGE. At each time point, a 12 lL aliquot of the reaction ... (Protein Data Bankaccession number 1j 8a) with Asn in this position, albeitwith F,W angles far from the allowed Ramachandranregion, are virtually identical to that of FVIIa. Model-ling of Ala372(223)...
  • 11
  • 619
  • 0
Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

... mori: characterization andimmunohistochemistry. Mol Cell Endocrinol 51, 22 7– 235.41 Nagata K, Maruyama K, Nagasawa H, Urushibata I,Isogai A, Ishizaki H & Suzuki A (1992) Bombyxin-IIand its ... sequence tag databaseon kaikoblast (http://kaikoblast.dna.affrc.go.jp/)revealed five cDNA clones that encoded an identicalpeptide sequence composed of a putative 20 aminoacid signal peptide and a ... concentrated the ELISA-positive material into a peak so sharp that we judgedthat sufficient purification had been achieved.Determination of the structure of 8K-BLPMALDI-TOF MS analysis of the...
  • 12
  • 707
  • 0
Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants doc

Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants doc

... betweenarginine and canavanine for aminoacylation of the planttRNA transcript was observed when using [14C]-canava-nine. At 0.4 mm canavanine, less than 10% of the tRNAwas aminoacylated compared ... further decrease the stability of the canavany-lated species.The role of tRNA as a cofactor for aminoacylationin those aminoacyl-tRNA synthetases that requiretRNA for amino acid activation is ... 5. Stability of canavanyl-tRNA. Jack bean transcript tRNAArgthat had been aminoacylated with [14C]-L-canavanine was incubatedin the absence of enzyme (), or in the presence of jack bean(d)...
  • 12
  • 559
  • 0
Tài liệu Báo cáo khoa học: Hypoxia downregulates farnesoid X receptor via a hypoxia-inducible factor-independent but p38 mitogen-activated protein kinase-dependent pathway doc

Tài liệu Báo cáo khoa học: Hypoxia downregulates farnesoid X receptor via a hypoxia-inducible factor-independent but p38 mitogen-activated protein kinase-dependent pathway doc

... Kashimura1, ToshihiroAkita1, Susumu Saitou1, Takehisa Atsumi1, Takashi Sato1, Ken Ando1, Shuntaro Hara2, KiyomiKikugawa1and Makio Hayakawa11 School of Pharmacy, Tokyo University of ... Pharmacy and Life Science, Japan2 School of Pharmaceutical Sciences, Showa University, Tokyo, JapanNuclear receptors (NRs) are ligand-activated transcrip-tional factors that belong to a large ... thefollowing validated siRNAs: Hs_MAPK14_6_HP validatedsiRNA against human p3 8a; Hs_MAPK3_7_HP validatedsiRNA against human ERK1; and Hs_MAPK1_10_HPvalidated siRNA against human ERK2. HepG2...
  • 14
  • 414
  • 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

... CGATTTGCTGACCACCTTCTMLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATCMLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAAMLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTGMLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTGHOXC13-ERE1 ... TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACCERa antisense CATGGTCATGGTCAG a ERb antisense GAATGTCATAGCTGA a MLL1 antisense TGCCAGTCGTTCCTCTCCAC a MLL2 antisense ACTCTGCCACTTCCCGCTCA a MLL3 antisense CCATCTGTTCCTTCCACTCCC a MLL4 ... uniquefeatures and unanswered questions. Biol Reprod 54,30 3–3 11.50 Woldemariam GA & Mandal SS (2008) Iron(III)-salendamages DNA and induces apoptosis in human cellvia mitochondrial pathway....
  • 12
  • 518
  • 0
Tài liệu Báo cáo khoa học: Calcium-binding to lens bB2- and bA3-crystallins suggests that all b-crystallins are calcium-binding proteins pptx

Tài liệu Báo cáo khoa học: Calcium-binding to lens bB2- and bA3-crystallins suggests that all b-crystallins are calcium-binding proteins pptx

... molecularstructure and stability of the eye lens: x-ray analysis of gamma-crystallin II. Nature 289, 77 1–7 77.43 Delamere NA & Paterson CA (1981) Hypocalcaemiccataract. In Mechanisms of Cataract Formation ... (Stains-all). J BiolChem 260, 598 5–5 990.30 Sharma Y, Rao CM, Rao SC, Krishna AG,Somasundaram T & Balasubramanian D (1989)Binding site conformation dictates the color of the dyestains-all. ... 9 6–1 01.15 Rajini B, Graham C, Wistow G & Sharma Y (2003)Stability, homodimerization, and calcium-binding prop-erties of a single, variant betagamma-crystallin domain of the protein absent...
  • 13
  • 449
  • 0
Tài liệu Báo cáo khoa học: Chemical approaches to mapping the function of post-translational modifications ppt

Tài liệu Báo cáo khoa học: Chemical approaches to mapping the function of post-translational modifications ppt

... vivoevolution of a tRNA synthetase–tRNA pair fromMethanococcus jannaschii capable of accepting andloading glycosylated amino acids has allowed theintroduction of O-b-d-GlcNAc-l-Ser [25] andO -a- d-GalNAc-l-Thr ... ligation.Particularly striking was the broad substrate tolerancethat could be engineered (e.g. towards non-naturalamino acids) by appropriate incorporation of the polardomain [47]. In an example ... approaches to mapping the function of post-translational modificationsDavid P. Gamblin, Sander I. van Kasteren, Justin M. Chalker and Benjamin G. DavisChemistry Research Laboratory, Department of Chemistry,...
  • 11
  • 682
  • 1
Tài liệu Báo cáo khoa học: Bacterial-induced hepoxilin A3 secretion as a pro-inflammatory mediator pptx

Tài liệu Báo cáo khoa học: Bacterial-induced hepoxilin A3 secretion as a pro-inflammatory mediator pptx

... recruits anADP-ribosylation factor 6 guanine nucleotide exchangefactor (such as ARNO) to the apical plasma mem-brane. ARNO facilitates ADP-ribosylation factor 6activation at the apical membrane, ... dis-ease because 12-LOX activity is induced at active sites of this disease.Because HXA3may play an important step underly-ing the pathophysiology of inflammatory diseases, suchas inflammatory ... theobjective of this review was to highlight the recent findings that implicatehepoxilin A 3as a key regulator of mucosal inflammation.AbbreviationsAA, arachidonic acid; HpETE, hydroperoxy-eicosatetraenoic...
  • 6
  • 524
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfbao cao khoa hoc ve yeu to anh huong den muc do hai long voi nguoi nop thuetài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịnghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ