Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mikko Nikinmaa 1 1 Centre ... anti- bodies for the transcription factor are available. The assay is the first assay suitable for high-throughput measurements of transcription factor DNA interac...

Ngày tải lên: 18/02/2014, 14:20

9 457 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating...

Ngày tải lên: 19/02/2014, 12:20

11 566 0
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... messages in microblogs. Our system can be regarded as a sentiment-driven, music-based sum- marization framework as well as a novel audiovis- ual presentation of art. MemeTube is designed as a ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptua...

Ngày tải lên: 20/02/2014, 05:20

6 449 0
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... text spans; for exam- ple, because, since, and for this reason are dif- ferent markers for causal relations. Discourse markers are a syntactically quite heterogeneous group of words, many ... found a cheap bar. If one accepts these sentences as paraphrases, then the various discourse markers all need to be associated with the information that they sig- nal a concessive...

Ngày tải lên: 20/02/2014, 18:20

5 528 0
Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx

Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx

... general, a particular semantic interpretation of a sentence can be characterized by a set of lexical categories (or parts of speech), a syntactic struc- ture, and the semantic annotations associated ... information. Hence, we will show how to annotate a syntax tree so that various interpretations can be characterized differently. Semantic Tagging A popular linguistic approach...

Ngày tải lên: 20/02/2014, 21:20

8 412 0
Tài liệu Báo cáo khoa học: Seed-based systematic discovery of specific transcription factor target genes pptx

Tài liệu Báo cáo khoa học: Seed-based systematic discovery of specific transcription factor target genes pptx

... tailed primers DARSfw (5¢-ACTACGCGTAGTCCAAGAGAGGAGAAACC -3¢) and DARSrv (5¢-ACTCTCGAGCCCGGAGCGCTGGCG GCCGC-3¢), and NFKBIAfw (5¢-ACTGAGCTCCCGA CGACCCCAATTCAAATCG-3¢) and NFKBIArv (5¢-ACT GAAGCTTTGTGGGCTCTGCAGCGCCGC-3¢). The ... expres- sion regulation. Nucleic Acids Res 29, 281–283. 4 Sandelin A, Alkema W, Engstrom P, Wasserman WW & Lenhard B (2004) JASPAR: an open-access database for...

Ngày tải lên: 18/02/2014, 18:20

15 500 0
Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

... H & Barabasi AL (2000) Error and attack tolerance of complex networks. Nature 406, 378–382. 36 Ravasz E, Somera AL, Mongru DA, Oltvai ZN & Bar- abasi AL (2002) Hierarchical organization ... Riechmann JL, Heard J, Martin G, Reuber L, Jiang C, Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RR et al. (2000) Arabidopsis transcription factors: genome- wide comparative analysis among eu...

Ngày tải lên: 19/02/2014, 07:20

12 511 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases...

Ngày tải lên: 15/02/2014, 01:20

13 641 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolve...

Ngày tải lên: 16/02/2014, 09:20

14 614 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... China Introduction Ischaemic heart disease is a life-threatening condition that may cause sudden cardiac failure and death. Many researchers have investigated cell transplantation as an alternative treatment for ... Pesce JT, Ramalingam TR, Thompson RW, Kamanaka M, Flavell RA, Keane-Myers A et al. (2007) IL-13Ralpha2 and IL-10 coordinately suppress airway inflammation, airway-hyperreacti...

Ngày tải lên: 18/02/2014, 04:20

11 653 0
w