Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG ScCoq7-b CCCCCGGGGCCACTTTCTGGTG Spcoq7 -a GTACAAGCTTGTAAATTTTCGATGG Spcoq7-b CATAGAATTCTTGGTAATC Spcoq7-c AAAGTCGACATGTTGTCACGTAGACAG Spcoq7-w...

Ngày tải lên: 18/02/2014, 14:20

... protein claudin-7 correlates with histological grade in both ductal carcinoma in situ and invasive ductal carcinoma of the breast. Oncogene 22, 2021–2033. 25 Agarwal R, D’Souza T & Morin PJ ... shown to be in the plasma membrane, including CEACAM5, CEACAM6, VDAC1, VDAC3, isoform 1 of tapasin (TAPBP), SLC2 5A4 , HLA -A1 , CLDN3, ITGB2, Galectin-3 and keratin type II cytoskeleta...

Ngày tải lên: 16/02/2014, 15:20

... protease decreases the volume of the S4 pocket while maintaining its apo- lar character. This may explain why all branched-chain aliphatic amino acid residues (Leu, Ile, Val) can be found in the P4 ... substrates was used to assess the specificity of the A1 69L and K22 0A mutants (Table 2). In general, the mutant enzymes suffered a substantial loss of catalytic power, but the...

Ngày tải lên: 19/02/2014, 16:20

... substantia nigra pars compacta and appearance of Lewy bodies consisting of aggregated protein, mainly a- synuclein, in Keywords amyloid; fibrillation; Parkinson’s disease; synuclein; thioflavin T Correspondence I. ... MPTP and MPP + can facilitate aggregation of a- synuclein in the absence of any cellular machinery. It has been proposed that the auto-oxidation product of dopamin...

Ngày tải lên: 14/02/2014, 19:20

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotake Ichise Laboratory of Gene E...

Ngày tải lên: 18/02/2014, 17:20

... zig-zag (areas 1 and 2), disordered (area 3) and dimer (area 4) lattices. (B) Zig-zag lattice (area 2), square lattice (area 5) and dimers (area 6). (C) Zig-zag lattice (area 1) and dimers (area ... obtained within one preparation. AFM images allow the differences in protein packing and interaction within the membrane to be visualized. Within the packed lattices, we find a new conforma- ti...

Ngày tải lên: 18/02/2014, 18:20

... 4753 Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor Sergey N. Fedosov 1 , Charles ... Haber E & Olesen H (1971) Nature of vitamin B 12 binding. II. Steric orientation of vitamin B 12 on binding and number of combining sites of human intrin- sic factor and the transc...

Ngày tải lên: 19/02/2014, 05:20

... Miyamoto K, Tanaka K, Kawai M, Tainaka K, Imada C, Okami Y & Inamori Y (1993) Cloning and sequence of an alkaline serine protease-encoding gene from the marine bacterium Alteromonas sp. strain O-7. ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) a...

Ngày tải lên: 19/02/2014, 07:20

... Gonza ´ lez Cappa SM, Katzin AM, An ˜ asco N & Lajma- novich S (1981) Comparative studies on infectivity and surface carbohydrates of several strains of Trypanosoma cruzi. Medicina (B Aires) ... Aires, Argentina Trypanosoma cruzi, the etiological agent of Chagas’ disease, is a parasitic protozoan with a digenetic life cycle involving an insect vector and a mammalian host. Th...

Ngày tải lên: 19/02/2014, 07:20

... Ohno-Iwashita Y, Shimada Y, Waheed AA, Hayashi M, Inomata M, Nakamura M, Maruya M & Iwashita S (2004) Perfringolysin O, a cholesterol-binding cytolysin, as a probe for lipid rafts. Anaerobe ... 10, 125–134. 19 Waheed AA, Shimada Y, Heijinen HFG, Nakamura M, Inomata M, Hayashi M, Iwashita S, Slot JW & Ohno- Iwashita Y (2001) Selective binding of perfringolysin O derivative to cho...

Ngày tải lên: 20/02/2014, 03:20