Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx

... exclusion, whereas phosphorylated EIIA activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The ... Catabolite repression in Escherichia coli – a comparison of modelling approaches Andreas Kremling, Sophia Kremling and Katja Bettenbrock Systems...

Ngày tải lên: 18/02/2014, 13:20

... three partners of Grb14 involved in insulin signaling have been identified: (a) protein kinase Cf interacting protein (ZIP), an adaptor protein that binds to the PIR domain of Grb14 and mediates ... immunoreactive Grb14 was examined using preparative and analytical fractionation and compared to that of the IR. Upon differential centrifugation (Fig. 1A) , Grb14 was detect- able as a...

Ngày tải lên: 18/02/2014, 18:20

... this strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity ... the biosynthesis of phenylalanine and tyrosine [11]. In this system, a strain of Escherichia coli was engineered in which the genes encoding the bifunctional CM–prephanate...

Ngày tải lên: 19/02/2014, 12:20

... forward primer), 5¢-CAGGTAACCGTGCGCG ACGCAAGCTCAACCAGGTCGAAG-3¢ (H18 1A, reverse primer), 5¢-GTTGAGCTTCACTCTGCGGCGGGTTACC TGCTGCATCAG-3¢ (H184, forward primer) and 5¢-CTG ATGCAGCAGGTAACCCGCCGCAGAGTGAAGCTCA AC-3¢ ... Schaller F & Weiler EW (1997) Molecular cloning and characterization of 12-oxophytodienoate reductase, an enzyme of the octadecanoid signaling pathway from Arabidopsis tha...

Ngày tải lên: 20/02/2014, 02:21

... respec- tively, such that Adj A 1 and Adj A 2 are mutu- ally reinforcing. The combination is indexed on Adj A 1 +Adj A2 . Example: “as dark and sophisticated as a chocolate martini”. (3) Adj A Noun S where ... comple- ment of adjectival properties used by Veale and Hao (2007), we harvest all instances of the patterns “as ADJ and * as” and “as * and ADJ as” from Google, noti...

Ngày tải lên: 20/02/2014, 05:20

... interuniversi- taria. From a contrastive point of view, the pre- fixation of relational adjectives exists in both languages (Italian and French) and in both these languages prefixing a noun to create an adjective ... neologisms are recognised, analysed and trans- lated. 6.2 Evaluation of the performance of the analysis As we previously stated, the analysis step can actu...

Ngày tải lên: 22/02/2014, 02:20

... Natl Acad Sci USA 99, 1177 8–1 1783. 9 Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T, Morrey CE, Shibata N, Asakawa S, Shimizu N et al. (2002) DMY is a Y-spe- cific DM-domain ... 7,3. 52 Matsuda M, Shinomiya A, Kinoshita M, Suzuki A, Kobayashi T, Paul-Prasanth B, Lau EL, Hamaguchi S, Sakaizumi M & Nagahama Y (2007) DMY gene induces male development in genetic...

Ngày tải lên: 14/02/2014, 19:20

... proteins, and thus allows their analysis by SDS ⁄ PAGE. Subcellular fractionation of porcine striatal brain tissue Porcine brain cut in half in the saggital plane was obtained fresh from a local abattoir ... granular intracellular staining compatible with an association with vesicles and the plasma membrane. p2 5a showed cytosolic staining, was localized in the cytosol with a les...

Ngày tải lên: 14/02/2014, 21:20

... by vascular endothelial cells may be a mediator linking smoking to cardiovascular disease in an autocrine or paracrine manner. Blocking ANGPTL2 signaling may also be beneficial also in preventing ... of ANGPTL2 signaling as a therapeu- tic strategy is more beneficial. Because ANGPTL2 promotes vascular in ammation via the a5 b1 integrin ⁄ Rac1 ⁄ NF-jB pathway [15] and vascular injury...

Ngày tải lên: 14/02/2014, 22:20

... coenzyme analog lacking the ade- nine ring in the upper axial ligand; a model of damaged cofactors) for free adeninylpentylcobalamin (AdePeCbl) (an inactive coenzyme analog containing the adenine ring ... cavity is comparable with that of adenine- lacking cobalamins, and thus allows the damaged cofactor to pass through it. Intact cofactor, an ade- nine-containing cobalamin, is not rel...

Ngày tải lên: 15/02/2014, 01:20