Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... 4183 Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and ... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT*...

Ngày tải lên: 18/02/2014, 11:20

... exception that sonication was used instead of high pressure homogenization, the purification was conducted on an A ¨ KTAxpress system (GE Healthcare). Crystallization, data collection and structure determination Crystals ... phosphoribosyl- transferase activity [10]. The structural characterization of numerous com- plexes of the human HPRT and several bacterial and pr...

Ngày tải lên: 15/02/2014, 01:20

... wavenumber values, indicating the loss of b-sheet and the onset of a- helix structure formation. To visualize the trend in the formation of b-sheet as a function of increasing SDS concentrations, the ratio ... between C-peptide and insulin, leading to an effect on the oli- gomer. The effect of NaCl and formamide on oligomer formation was also tested. NaCl...

Ngày tải lên: 18/02/2014, 04:20

... 50 and near 100%) [63,77]. At this point, the data suggest that K eq A and the associated k on and k off conforma- tional rates are primary factors in regulating the cyto- chrome c reductase activity ... domain has fundamen- tal structural, thermodynamic and mechanistic features in common with the dual-flavin family of reductases, there are unique aspects related to NO...

Ngày tải lên: 18/02/2014, 11:20

... MM & Kostic NM (1996) Effects of temperature on the kinetics of the gated electron- transfer reaction between zinc cytochrome c and plastocyanin. Analysis of configurational fluctuation of the ... reduction during the reaction of the wild-type (wt) and N18 9A mutant of MR with NADH. The wt trace is fit to a single exponential and the N18 9A trace to a...

Ngày tải lên: 18/02/2014, 11:20

... F X ,F A and F B .F X is coordinated by cysteines located in both of the large PSI subunits, PsaA and PsaB, via a loop that also plays a role in the attachment of PsaC [12]. PsaC, PsaD and PsaE are located ... in favour of a stronger H-bond between the carbonyl of N58 (‘O-up’ conformation) and FMN N(5)H [41]. The semiquinone states of A. nidulans and Ana...

Ngày tải lên: 18/02/2014, 11:20

... Lapierre C & Dumont M (1993) Isolation and characterization of histogranin, a natural peptide with N-methyl-D- aspartate antagonist activity. Eur J Pharmacol Mol Pharmacol 245, 247–256. 15 Lemaire ... oxidation DNP (A, B), the aconitase inhibitor fluoroacetate (C, D) and the inhibitor of DNA gyrase-linked ATPase, coumermycin A1 (E, F) on the bactericidal activity of...

Ngày tải lên: 18/02/2014, 14:20

... b-strands, six a- helices and three 3 10 -helices. The core of the pro- tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 Structure of Salmonella ... Studies have shown that there is a functional relationship between SurE and Pcm. l-isoaspartate O-methyltransferase converts isoapartyl residues to l-aspa...

Ngày tải lên: 18/02/2014, 14:20

... antagonism in the REF assay, subcellular localization, and transcrip- tional activity. Some of these analyses have assigned differential functions to the two isoforms, and we show that the unique ... transcriptional repression and activation domains, WT1s lacks the repression domain and, conse- quently, has different effects on downstream targets and in growth ⁄ cancer...

Ngày tải lên: 18/02/2014, 16:20

... and part of the His-tag was observed in the B chain. A few amino acid residues are found in disallowed regions in the Ramachandran plot; these are A4 , A1 65, A1 67, B3, B4 and F165, all of which are ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP. In order to determine the true K m for UMP and ATP, a two-substrate assay was pe...

Ngày tải lên: 18/02/2014, 16:20