Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp CCS1 docx
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... 2009 The Authors Journal compilation ª 2009 FEBS Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 Yuanheng Cai1, Peter Trodler2, Shimin Jiang1, ... high-activity D-hydantoinase from Jannaschia sp. CCS1 FEBS Journal 276 (2009) 3575–3588 ª 2009 The Authors Journal compilation ª 2009 FEBS 3579 characterization and evaluation of HYDJs from Jannaschia ... Metab Dispos 2,103–112.11 Moller A, Syldatk C, Schulze M & Wagner F (1988)Stereo- and substrate-specificity of a d-hydantoinase and a d-N-carbamyl amino acid amidohydrolase of Arthrobacter...
- 14
- 621
- 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... sites using a forwardoligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCGCAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCTCGAATTCG GATCCGGTACCTCAGAAGGTAGACAGCAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cyssequence ... chain and hides a large amount of the hydrophobic surface area. Surfacearea calculations for the pentamer give a total surfacearea of 81 000 A ˚2with 30% ( 24 000 A ˚2) as con-tact area. ... Gly-Gly-Cyssequence was introduced at the C-terminus using oligomers5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAATTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAGCAACCTCCAAAGGTAGACAGCA-3¢ (reverse). BL21cells were transformed...
- 10
- 647
- 0
Tài liệu Báo cáo khoa học: Biochemical and molecular characterization of hazelnut (Corylus avellana) seed lipoxygenases pdf
... 5¢-AAGATGAAACGTGAGACGG-3¢ (CA1); 5¢-GATGACATCTCCATGGAATAC-3¢ (CA2). The 3¢ region of the hazelnut LOX cDNAwas amplified using the following primers: 5¢-GTTTGGAAGAGAGATGCTGG-3¢ (CA3); 5¢-AAAGTTTTTAGATTGAGACACTATTGGGAATT-3¢ ... were obtained byPCR using hazelnut genomic DNA as template, theprimers 5¢-CTATGATTATGATGTCTACAATGATTTGGG-3¢ (ML1) and 5¢-GCAAATTCTTCATCAGTCATCCATGCAGAC-3¢ (ML2) and the following amplificationconditions: ... Nucleotide and deduced amino acidic sequences of thehazelnut LOX gene. The inverted repeats are in bold and their orientations are indicated by arrows. TATA and CAAT boxes and the initiatingATG are also...
- 11
- 404
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx
... Canyuk B, Focia PJ & Eakin AE (2001) The role foran invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and ... 6615–6627.24 Raman J, Sumathy K, Anand RP & Balaram H (2004) A non-active site mutation in human hypoxanthineguanine phosphoribosyltransferase expands substratespecificity. Arch Biochem Biophys ... side chain of Asp201, a phosphate ion and five water molecules.The phosphate involved in this interaction is bound bymain chain interactions with Lys76 and Gly77 and the side chain of Arg207....
- 11
- 770
- 0
Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc
... product. Sense primer, 5¢-GAGAGAGGATCCATATGACAAAAACCGAGTTAC-3¢, NdeIsite; antisense primer, 5¢-GAGAGAAAGCTTCAAAACTGGGACAGTTG-3¢, HindIII site.The same method was used to amplify the codingsequence ... Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E,Nakamura Y, Miyajima N, Hirosawa M, Sugiura M,Sasamoto S et al. (1996) Sequence analysis of the gen-ome of the unicellular cyanobacterium Synechocystis ... forward primer1, 5¢-ATGGCGGCGATTACAGAATT-3¢, reverse primer1,5¢-TCAAGCAAGGATCAGAGTGA-3¢. The sequence wasobtained from the TIGR database (At1g65820 68408.m06848putative microsomal glutathione...
- 16
- 524
- 0
Báo cáo khoa học: Isolation and structural characterization of the Ndh complex from mesophyll and bundle sheath chloroplasts of Zea mays pptx
... chloroplastswere separated in CN ⁄ PAGE (1D, the hori-zontal bands) and then in nondenaturingconditions by BN ⁄ PAGE (2D). The molecular mass standards and direction of migrationare indicated ... Sazanov LA, Burrows PA & Nixon PJ (1998) The plastidndh genes code for an NADH-specific dehydrogenase: isolation of a complex I analogue from pea thylakoidmembranes. Proc Natl Acad Sci USA 95, ... suggest that the Ndh complex exists as a monomer and dimer and splits into a membrane and soluble subcomplexes.Separation of the Ndh complex by CN/PAGE(1D) and Tricine/PAGE (2D) and CN/PAGE...
- 12
- 431
- 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx
... Fernadez-Larrea, J. & Stahl, U. (1996) Isolation and character-ization of a laccase gene from Podospora anserina. Mol. Gen.Genet. 252, 539–551.36. Saloheimo, M., Niku-Paavola, M L. & ... Biochemical and molecular characteri-zation of the diphenol oxidase of Cryptococcus neoformans:iden-tification as a laccase. J. Bacteriol. 176, 656–664.39. Zhao, J. & Kwan, H.S. (1999) Characterization, ... cycles of 94 °Cfor20s,52°Cfor20s and 70 °C for 2 min; then a final extension at 72 °Cfor 10 min. The primers for lac1 PLAC1F(5¢-AGCTTTCATTCCCAGTGATTG-3¢)andPLAC1R(5¢-AACGAGCTCAAGTACAAATGACT-3¢)...
- 11
- 703
- 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx
... withinthe last 30 years. The greatest number of RIPs havebeen found in the Caryophyllaceae, Sambucaceae,Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... Roberts3 and Ana Paula U. Arau´jo1,21 Programa de Po´s-graduac a o em Gene´tica e Evoluc a o, Universidade Federal de Sa˜o Carlos, Brazil2 Instituto de Fı´sica de Sa˜o Carlos, Universidade ... displayed hemagglutination and toxicitytoward mice (data not shown), additional efforts tocleanly isolate the isoform were not successful and further characterization was abandoned. A chromato-focusing...
- 12
- 763
- 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... Functional and structural analyses of N-acylsulfonamide-linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3 and K. Ravi Acharya11 Department ... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-bindingproteins.DatabaseStructural data for the two RNase A complexes are available in the Protein Data Bank ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A notoriously stable...
- 9
- 626
- 0
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc
... GCATCAACTTTCAAAAGATF127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAGR144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATACI152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCATN154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGTK31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTTY55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACTT56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG CAGCAAGCACATAATCCATGTCAAACCCAAAACACTRegulation ... AGAATGTAAAATCTTTCAGTK31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACCG319D GGACCCCTTACAGCA GTGTAGGTACCAATTTTCD39 6A GGCTATTTTCTTGGCTGA AAGCTCTGAAGCTCTTCM436W GTGGATGGGGAGCCTG CCGTAGCACATGTCCAH428D AAGAAAGTAACTGACGACATGGACATGTG...
- 10
- 563
- 0
Từ khóa: báo cáo khoa học tài liệu báo cáo tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ