... 2009 The Authors Journal compilation ª 2009 FEBS Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 Yuanheng Cai 1 , Peter Trodler 2 , Shimin Jiang 1 , ... high-activity D-hydantoinase from Jannaschia sp. CCS1 FEBS Journal 276 (2009) 3575–3588 ª 2009 The Authors Journal compilation ª 2009 FEBS 3579 characterization an...
Ngày tải lên: 18/02/2014, 08:20
... sites using a forward oligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence ... chain and hides a large amount of the hydrophobic surface area. Surface area calculations for the pentamer give a total surface area of 81 000 A ˚ 2 with 30%...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Biochemical and molecular characterization of hazelnut (Corylus avellana) seed lipoxygenases pdf
... 5¢-AAGATGAAACGTG AGACGG-3¢ (CA1); 5¢-GATGACATCTCCATGGAA TAC-3¢ (CA2). The 3¢ region of the hazelnut LOX cDNA was amplified using the following primers: 5¢-GTTT GGAAGAGAGATGCTGG-3¢ (CA3); 5¢-AAAGTTTTT AGATTGAGACACTATTGGGAATT-3¢ ... were obtained by PCR using hazelnut genomic DNA as template, the primers 5¢-CTATGATTATGATGTCTACAATGATTTG GG-3¢ (ML1) and 5¢-GCAAATTCTTCATCAGTCATC CATGCAGAC-3¢ (M...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx
... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional analysis, and ... 6615–6627. 24 Raman J, Sumathy K, Anand RP & Balaram H (2004) A non-active site mutation in human hypoxanthine guanine phosphoribosyltransferase expands substrate specificity. Arch Biochem...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc
... product. Sense primer, 5¢-GAGA GAGGATCCATATGACAAAAACCGAGTTAC-3¢, NdeI site; antisense primer, 5¢-GAGAGAAAGCTTCAAAACT GGGACAGTTG-3¢, HindIII site. The same method was used to amplify the coding sequence ... Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N, Hirosawa M, Sugiura M, Sasamoto S et al. (1996) Sequence analysis of the gen- ome of the unicellular cyanobacte...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Isolation and structural characterization of the Ndh complex from mesophyll and bundle sheath chloroplasts of Zea mays pptx
... chloroplasts were separated in CN ⁄ PAGE (1D, the hori- zontal bands) and then in nondenaturing conditions by BN ⁄ PAGE (2D). The molecular mass standards and direction of migration are indicated ... Sazanov LA, Burrows PA & Nixon PJ (1998) The plastid ndh genes code for an NADH-specific dehydrogenase: isolation of a complex I analogue from pea thylakoid membranes. Proc Nat...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx
... Fernadez-Larrea, J. & Stahl, U. (1996) Isolation and character- ization of a laccase gene from Podospora anserina. Mol. Gen. Genet. 252, 539–551. 36. Saloheimo, M., Niku-Paavola, M L. & ... Biochemical and molecular characteri- zation of the diphenol oxidase of Cryptococcus neoformans:iden- tification as a laccase. J. Bacteriol. 176, 656–664. 39. Zhao, J. & Kwan...
Ngày tải lên: 07/03/2014, 15:20
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx
... within the last 30 years. The greatest number of RIPs have been found in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... Roberts 3 and Ana Paula U. Arau ´ jo 1,2 1 Programa de Po ´ s-graduac a o em Gene ´ tica e Evoluc a o, Universidade Federal de Sa˜o Carlos, Brazil 2 Instituto de Fı ´ sica de Sa˜o Carlos...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... Functional and structural analyses of N-acylsulfonamide- linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 and K. Ravi Acharya 1 1 Department ... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are ava...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc
... GCATCAACTTTCAAAAGAT F127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGT K31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTT Y55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG...
Ngày tải lên: 15/02/2014, 01:20