Tài liệu Báo cáo khoa học: Anaerobic sulfatase-maturating enzyme – A mechanistic link with glycyl radical-activating enzymes? docx
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt
... hydroperoxide, following a peroxidase-like two-step oxygen-transfer mechanisminvolving a radical–cation intermediate. The best system,associating H2O2as oxidant and 3A3 –MP8 as a catalyst, inthe presence ... orÔhemoabzymesÕ, are not as efficient a category of catalysts astheir natural hemoprotein counterparts. The hemoabzymes,which display a peroxidase activity, are characterized bykcat/Kmvalues ... conditionsBefore the 3A3 –MP8 complex was assayed as a catalyst forthe S-oxidation of thioanisole, the reaction conditions wereoptimized with MP8 alone acting as a catalyst. For thispurpose, thioanisole,...
- 7
- 447
- 0
Tài liệu Báo cáo khoa học: "Supervised Grammar Induction using Training Data with Limited Constituent Information *" docx
... hand-labeled train- ing data with that of hand-coded grammar. Our idea of grammar adaptation can be seen as a form of initialization. It attempts to seed the grammar in a favorable search space by ... accuracy, whereas an adapted grammar parses with 72% accuracy, which is 6% lower than the score of a grammar induced from fully labeled training data. That the most informative brackets are ... significant difference is when the training data contains no label information at all. The adapted grammar parses with 60.1% accuracy whereas the directly induced grammar parses with 49.8% accuracy....
- 7
- 423
- 0
Tài liệu Báo cáo khoa học: "Matching Readers’ Preferences and Reading Skills with Appropriate Web Texts" docx
... (Collins-Thompson andCallan, 2004) is based on web data that have beenannotated and indexed off-line. Also, relatedly,(Schwarm and Ostendorf, 2005) use a statisticallanguage model to train SVM classifiers ... system that performs in real time a) keywordsearch, b)thematic classification and c)analysis ofreading difficulty. Search results and analyses arereturned within a few seconds to a maximum of a minute ... Read-X is enhanced with an added com-ponent which predicts difficult vocabulary giventhe user’s educational level and familiarity with specific thematic areas.2 Web search and text classificationInternet...
- 4
- 330
- 0
Tài liệu Báo cáo khoa học: Anaerobic sulfatase-maturating enzyme – A mechanistic link with glycyl radical-activating enzymes? docx
... 190 6–1 920 ª 2010 The Authors Journal compilation ª 2010 FEBS Anaerobic sulfatase-maturating enzyme – A mechanistic link with glycyl radical-activating enzymes? Alhosna Benjdia1, Sowmya Subramanian2,Je´roˆme ... anaerobic sulfatase-maturating enzyme; anSMEcp, Clostridium perfringens anaerobic sulfatase-maturating enzyme; anSMEkp, Klebsiella pneumoniae anaerobic sulfatase-maturating enzyme; 5¢-dA, 5¢-deoxyadenosine; ... Guillot A, Vaudry H, Rabot S& Berteau O (2007) Anaerobic sulfatase-maturating enzymes: radical SAM enzymes able to catalyze in vitrosulfatase post-translational modification. J Am ChemSoc...
- 15
- 559
- 0
Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx
... aninteraction partner for ADAM10 that enhances a- sec-retase shedding of APP, probably by regulating matu-ration of the prodomain of ADAM10 [22].The catalytical domain of ADAM10 contains a typical zinc-binding ... Borroni B, Zimmermann M,Caltagirone C, Cattabeni F, Padovani A & Di LM(2004) Platelet APP, ADAM 10 and BACE alterationsin the early stages of Alzheimer disease. Neurology 62,49 8–5 01.90 Bernstein ... 102,159 5–1 605.106 Arduise C, Abache T, Li L, Billard M, Chabanon A, Ludwig A, Mauduit P, Boucheix C, Rubinstein E &Le NF (2008) Tetraspanins regulate ADAM10-medi-ated cleavage of TNF-alpha and...
- 12
- 591
- 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... Milne TA, CopelandTD, Levine SS, Lee JC, Hayes DN, Shanmugam KS,Bhattacharjee A, Biondi CA et al. (2004) Meninassociates with a trithorax family histone methyltrans-ferase complex and with ... H4 K16acetyltransferase MOF. Cell 121, 87 3–8 85.17 Yokoyama A, Wang Z, Wysocka J, Sanyal M, AufieroDJ, Kitabayashi I, Herr W & Cleary ML (2004)Leukemia proto-oncoprotein MLL forms a SET1-likehistone ... lysinemethyltransferases. J Biol Chem 280, 556 3–5 570.53 Qian C, Wang X, Manzur K, Sachchidanand, Farooq A, Zeng L, Wang R & Zhou MM (2006) Structuralinsights of the specificity and catalysis of a viralhistone...
- 11
- 761
- 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... fragment, andBiP Ala324–Leu653 as a SacI–XhoI fragment. Maturehuman ERp27 (Glu26–Leu273) was generated by PCRfrom IMAGE clone 5207225 as an NdeI–BamHI fragment.Mature E. coli DsbA (Ala20–Leu208) and ... DsbC,as well as the isolated catalytic a domain of PDI. Boththe PDI a domain and DsbA have a catalytic site, with an associated substrate-binding site, but lack an inde-pendent substrate-binding ... showing a greater effect(29% decrease in aggregation rate) than PDI (18%decrease in rate). When 1mm bacitracin was added tothe PDI-catalyzed reaction the rate of aggregation ofrhodanese was significantly...
- 9
- 620
- 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf
... Intracellular activation of gelatinase A (72-kDa type IV collagenase) by normal fibroblasts.Proc Natl Acad Sci USA 94, 442 4–4 429.60 Deryugina EI, Ratnikov BI, Yu Q, Baciu PC, RozanovDV & ... Biophys Acta 1803, 14 2–1 50.16 Gingras D, Bousquet-Gagnon N, Langlois S, Lacham-bre MP, Annabi B & Beliveau R (2001) Activation ofthe extracellular signal-regulated protein kinase (ERK)cascade ... Ollendorff V, Jaulin-Bastard F, Saito H, Fournier E, Adelaide J, Margolis B& Birnbaum D (2000) ERBIN: a basolateral PDZ pro-tein that interacts with the mammalian ERBB2/HER2receptor. Nat Cell...
- 18
- 603
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... 257,44 1–4 56.19 Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 28 1–2 89.20 Parthasarathy S, Ravindra G, Balaram ... and complementary mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and ... mutagenesis.Desired mutation Template gene Constructed mutant Primer sequence (5¢-to3¢) Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA...
- 15
- 635
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịnghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ