Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf
... chain A is close to Ala25 of chain B. Chain A Chain B Hydrogen bonds Ala25 Asn77, Arg80 AlaO–ArgNH1 AlaO–ArgND2 Asn26 His35, Arg80, Asn39 AsnOD1–ArgNH1 AsnOD1–HisNE2 Ser28 Arg76 Trp30 Arg42, ... of acidic stress response factor HP1286 FEBS Journal 277 (2010) 1896–1905 ª 2010 The Authors Journal compilation ª 2010 FEBS 1905 Helicobacter pylori acidic stress response...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants doc
... when assayed with non-radioactive cana- vanine using the [ 32 P]-labelled tRNA assay [28]. For the jack bean enzyme, a distinct discrimination between arginine and canavanine for aminoacylation ... method Aminoacylation of transcript tRNA with [ 14 C]-labelled amino acid Aminoacylation of [ 32 P]-labelled transcript tRNA Discrimination factor( k cat ⁄ K M ) Arg ⁄ (k cat ⁄ K M ) Cav Arg...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Chromatin under mechanical stress: from single 30 nm fibers to single nucleosomes pdf
... assembly and remodel- ing factor (ACF) assembled chromatin and (d) chro- matin assembled in nuclear extracts. These distinct substrates have different properties and advanta- ges ⁄ disadvantages ... lmÆs )1 revealed a sawtooth profile, which started to appear at forces above 20 pN and continued until about 40 pN. The analysis revealed three distinct characteristic DNA release lengths: 65,...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 ... primers: KGG3-2 forward d(AAA GGT GGC AAA GGT GGA GAC AGA GGT GGC TT) and KGG3-2 reverse d(GAA CAT TCC ACC GGG ACC ACC AC). pGEX–KGG3-4 was generated by PCR using pGEX–KGG2 as a template...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: 3T3-L1 adipocyte apoptosis induced by thiazolidinediones is peroxisome proliferator-activated receptor-c-dependent and mediated by the caspase-3-dependent apoptotic pathway doc
... The target mRNA was normalized against actin in the same sample. The PCR primers were as follows: actin forward, 5¢-GA AATCGTGCGTGACATCAAAG-3¢; actin reverse, 5¢-TG TAGTTTCATGGA TGCCACAG-3¢; Akt-1 ... 693 TTTTTCAGTGCAGAA-3¢; aP2 forward, 5¢-AAAGACA GCTCCTCCTCGAAGGTT-3¢; and aP2 reverse, 5¢-TGA CCAAATCCCCATTTACGC-3¢. Standard curves were gen- erated with 10-fold serial dilutions ranging from...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf
... 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA ACAAUGUGAAA GCAAUGUGAUA 5′ 3′ UAAAUGUGAAU ACUAAGAGUAA GCAAUGUGAUA IL6R mRNA mut 1 5′ 3′ UAAAUGUGAAU ACAAUGUGAAA GCUAAGAGUUA IL6R ... 5′3′ 3′ UAUAAGAGUAU CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx
... leaflets. We thus conclude from these data that Ab interacts with the membrane in a Table 4. Average values of deuterium order parameters. Data are the mean (± SD). Simulation Top leaflet plateau ... membrane-perturbing Ab40 peptide. Although it is known that Ab can interact with the plasma membrane and assemble in this environment [6], a fundamental understanding of the molecular bas...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt
... -ATC ATC TCC ATC GAC TAC TCC CTG-3¢, the antisense primer 5¢-AAG AAT TCT AGA TTA ATG GTG ATG ATG GTG ATG ATG GTG TGG GGT CAG CGG TGC AGC AGG GGG GGT-3¢ (XbaI sites underlined; His-tag in italic) ... not necessary, probably because of a lower degree of interaction of ATP with SYPRO Orange than with bis-ANS. The molar concentration of SYPRO Orange is impossible to calculate, as the mole...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface pdf
... Blake T, Mishra L & Mishra B (2008) TGF-beta signaling in neuronal stem cells. Dis Markers 24, 251–255. 36 Dohgu S, Yamauchi A, Takata F, Naito M, Tsuruo T, Higuchi S, Sawada Y & Kataoka ... Tomita S, Ueno M, Sakamoto M, Kitahama Y, Ueki M, Maekawa N, Sakamoto H, Gassmann M, Kageyama R, Ueda N et al. (2003) Defective brain development in mice lacking the HIF-1alpha gene in neural cel...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... WASP) -binding domain and a novel C-terminal actin -binding domain Thirumaran Thanabalu 1,2 , Rajamuthiah Rajmohan 2 , Lei Meng 2 , Gang Ren 4,5 , Parimala R. Vajjhala 4 and Alan L. Munn 1,3,4,6 * 1 ... vrp1D::KanMx bar1) [23], IDY166 (MATa his3 leu2 ura3 trp1 las17D::URA3 ) [20], and PJ69- 4A (MATa his3 leu2 ura3 trp1 gal4D gal80D met2::GAL7-lacZ GAL2-ADE2 LYS2::GAL1–HIS3) [64]. Yeast s...
Ngày tải lên: 18/02/2014, 16:20