Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

... of the other components of the MLL1 core complex catalyzes dimethylation of H3K4, we assembled the MLL1 core complex with a catalytically inactive MLL1 SET domain variant, and discovered that the ... these domains are used to regulate the targeting, assembly and enzymatic activity of MLL1 complexes. The MLL protein The MLL1 gene encodes a large protein...

Ngày tải lên: 16/02/2014, 14:20

... Nakamura T, Croce CM, Mazo A & Canaani E (1998) The C-terminal SET domains of ALL-1 and TRITHORAX interact with the INI1 and SNR1 proteins, components of the SWI ⁄ SNF complex. Proc Natl Acad ... neutralization [15]. Both H3K4 methylation and H4K16 acetyl transferase activities are required for optimal transactivation of the MLL1 target HOXA9 gene [15]. The MLL1 C-te...

Ngày tải lên: 16/02/2014, 14:20

... can- cer. The implication of HMTs and demethylases in cancer and human diseases has led to the idea of utiliz- ing them as therapeutic targets. In fact, biguanide and bisguanidine polyamine analogs ... Rozovskaia T, Burakov D, Sedkov Y, Tillib S, Blechman J, Nakamura T, Croce CM, Mazo A & Canaani E (1998) The C-terminal SET domains of ALL-1 and TRITHORAX interact with the...

Ngày tải lên: 16/02/2014, 14:20

... limits DNA damage and maintains self-renewal of leukaemia stem cells. Nature 457, 51–56. 49 Seoane J, Le HV, Shen L, Anderson SA & Massague ´ J (2004) Integration of Smad and forkhead pathways ... information The following supplementary material is available: Table S1. All protein- protein interaction data were obtained from the biogrid Database (www.thebiogrid.org) and listed ac...

Ngày tải lên: 16/02/2014, 14:20

... CGATTTGCTGACCACCTTCT MLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATC MLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAA MLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTG MLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTG HOXC13-ERE1 ... TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACC ERa antisense CATGGTCATGGTCAG a ERb antisense GAATGTCATAGCTGA a MLL1 antisense TGCCAGTCGTTCCTCTCCAC a MLL2 antisense...

Ngày tải lên: 18/02/2014, 14:20

... vials, and centrifuged for 15 min at 16 000 g and the supernatant was transferred to new vials. A fraction was retained for determination of total protein. The remainder of the supernatant was ... of DA is thought to be maintained by a regulated balance between the functional levels of plasma mem- brane DAT and vesicular VMAT-2. The protein a- synuclein (a- syn) is k...

Ngày tải lên: 14/02/2014, 21:20

... before an apparent increase in absorbance of 0.1 was recorded. The addition of PDI to the assay accelerated the reduc- tion and precipitation of the B-chain significantly, decreasing the lag-phase ... mechanism of action of bacitra- cin, the reduction of insulin was analyzed in the pres- ence of the PDI a domain and DsbA, which are capable of catalyzing the...

Ngày tải lên: 16/02/2014, 14:20

... of GIF are altered dramatically in the neurode- generative or traumatically injured brain. The best- characterized example of this is for AD. Indeed, many studies have analysed the amount of GIF ... of the current thoughts on the role of GIF in AD. There are numer- ous pathological hallmarks in AD that are commonly accompanied by neuronal alterations. These physical altera...

Ngày tải lên: 16/02/2014, 15:20

... immunoreactive Grb14 was examined using preparative and analytical fractionation and compared to that of the IR. Upon differential centrifugation (Fig. 1A) , Grb14 was detect- able as a major protein of 60 kDa in ... enrichments of the plasma membrane fraction in 5¢-nucleotidase and alkaline phosphodiesterase (plasma membrane markers) and of the Golgi ⁄ endosome fraction in...

Ngày tải lên: 18/02/2014, 18:20

... in accordance with the fact that the maximum stability and activity of the AAP occurs in the pH range 8.0–8.5 [23]. When evaluating the influence of Table 2. Thermodynamic parameters of the thermal ... completed because degradation of the protein was also observed after 6 h of reaction. Analysis of the data as a function of pH (Fig. 3), showed that cyclization...

Ngày tải lên: 19/02/2014, 12:20