0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

... of the othercomponents of the MLL1 core complex catalyzesdimethylation of H3K4, we assembled the MLL1 corecomplex with a catalytically inactive MLL1 SETdomain variant, and discovered that the ... thesedomains are used to regulate the targeting, assemblyand enzymatic activity of MLL1 complexes. The MLL protein The MLL1 gene encodes a large protein of 3969 aminoacid residues that contains several ... protein Michael S. Cosgrove and Anamika PatelDepartment of Biology, Syracuse University, NY, USAIntroductionChromosomal translocations that disrupt the mixed lineage leukemia protein- 1 gene (MLL1, ALL1,...
  • 11
  • 761
  • 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

... Nakamura T, Croce CM,Mazo A & Canaani E (1998) The C-terminal SETdomains of ALL-1 and TRITHORAX interact with the INI1 and SNR1 proteins, components of the SWI ⁄ SNFcomplex. Proc Natl Acad ... neutralization [15]. Both H3K4 methylationand H4K16 acetyl transferase activities are requiredfor optimal transactivation of the MLL1 targetHOXA9 gene [15]. The MLL1 C-terminal domain isalso an ... and regulate NR target geneactivation A widely studied NR coactivator is activating signalcointegrator-2 (ASC2, also named AIB3, TRBP,TRAP250, NRC, NCOA6 and PRIP) [69]. ASC2 is a coactivator...
  • 15
  • 607
  • 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: histone H3 lysine 4 methyltransferases from yeast to human pptx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: histone H3 lysine 4 methyltransferases from yeast to human pptx

... can-cer. The implication of HMTs and demethylases incancer and human diseases has led to the idea of utiliz-ing them as therapeutic targets. In fact, biguanide andbisguanidine polyamine analogs ... Rozovskaia T, Burakov D,Sedkov Y, Tillib S, Blechman J, Nakamura T, CroceCM, Mazo A & Canaani E (1998) The C-terminal SETdomains of ALL-1 and TRITHORAX interact with the INI1 and SNR1 proteins, ... geneexpression. Amorphic and antimorphic mutations in the Ash1 gene lead to a drastic decrease in the globallevel of H3K4 methyaltion [106–110]. The catalyticdomain of ASH1 is 588 amino acids long, and...
  • 17
  • 665
  • 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in human malignancies and potential therapy pdf

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in human malignancies and potential therapy pdf

... limitsDNA damage and maintains self-renewal of leukaemiastem cells. Nature 457, 51–56.49 Seoane J, Le HV, Shen L, Anderson SA & Massague´J(2004) Integration of Smad and forkhead pathways ... information The following supplementary material is available:Table S1. All protein- protein interaction data wereobtained from the biogrid Database (www.thebiogrid.org)and listed according their ... 115,293–303.12 Nakamura T, Mori T, Tada S, Krajewski W, RozovskaiaT, Wassell R, Dubois G, Mazo A, Croce CM & CanaaniE (2002) ALL-1 is a histone methyltransferase thatassembles a supercomplex of proteins...
  • 10
  • 657
  • 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

... CGATTTGCTGACCACCTTCT MLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATCMLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAAMLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTGMLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTGHOXC13-ERE1 ... TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACCERa antisense CATGGTCATGGTCAG a ERb antisense GAATGTCATAGCTGA a MLL1 antisense TGCCAGTCGTTCCTCTCCAC a MLL2 antisense ACTCTGCCACTTCCCGCTCA a MLL3 antisense CCATCTGTTCCTTCCACTCCC a MLL4 ... 7411 Mixed lineage leukemia histone methylases play criticalroles in estrogen-mediated regulation of HOXC13Khairul I. Ansari, Sahba Kasiri, Imran Hussain and Subhrangsu S. MandalDepartment of...
  • 12
  • 518
  • 0
Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx

Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx

... vials, and centrifuged for 15 min at 16 000 g and the supernatant was transferred to new vials. A fraction wasretained for determination of total protein. The remainder of the supernatant was ... of DA is thought to be maintained by a regulatedbalance between the functional levels of plasma mem-brane DAT and vesicular VMAT-2. The protein a- synuclein (a- syn) is known to play a central ... Because of the a- syn-mediated effect on DA uptake, abnormalfunction or aggregation of a- syn in dopaminergic neu-rons may affect the DA balance, and thereby increaseoxidative stress in the...
  • 13
  • 596
  • 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

... before anapparent increase in absorbance of 0.1 was recorded. The addition of PDI to the assay accelerated the reduc-tion and precipitation of the B-chain significantly,decreasing the lag-phase ... mechanism of action of bacitra-cin, the reduction of insulin was analyzed in the pres-ence of the PDI a domain and DsbA, which arecapable of catalyzing the oxidation and reduction reac-tions, ... reportsthat there is protease contamination of some commerciallyavailable bacitracin preparations [31], we were loathe tofractionate the material to ensure that there was no prote-ase contamination,...
  • 9
  • 620
  • 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

... of GIF are altered dramatically in the neurode-generative or traumatically injured brain. The best-characterized example of this is for AD. Indeed, manystudies have analysed the amount of GIF ... of the currentthoughts on the role of GIF in AD. There are numer-ous pathological hallmarks in AD that are commonlyaccompanied by neuronal alterations. These physicalalterations include aberrant ... into the potential role of GIFin neurofibrillary changes associated with AD.Potential role of metal-binding/exchangeproperties of GIF in ADOne of the primary pathological hallmarks of AD isthe...
  • 9
  • 664
  • 0
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx

Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx

... immunoreactiveGrb14 was examined using preparative and analyticalfractionation and compared to that of the IR. Upondifferential centrifugation (Fig. 1A) , Grb14 was detect-able as a major protein of 60 kDa in ... enrichments of the plasma membrane fractionin 5¢-nucleotidase and alkaline phosphodiesterase (plasmamembrane markers) and of the Golgi ⁄ endosome fraction ingalactosyltransferase (Golgi marker), ATP-dependent ... at the sameconcentration, and so was urea at 4 m. On the otherhand, treatment with 0.1 m Na2CO3(pH 11.5)removed at least 60–70% of Grb14, again leaving the IR membrane-associated (data...
  • 15
  • 497
  • 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

... in accordance with the fact that the maximum stability and activity of the AAP occurs in the pH range 8.0–8.5 [23]. When evaluating the influence of Table 2. Thermodynamic parameters of the thermal ... completed because degradation of the protein was also observed after 6 h of reaction.Analysis of the data as a function of pH (Fig. 3), showedthat cyclization at pH 2.5 is faster when the temperatureis ... equal volume of saturated sinapinic acid in the same solvent of the matrix, and 0.5 lL of the mixturewas immediately applied to a sample probe spot.Cyclization reaction as a function of pH and...
  • 9
  • 704
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị10 trần thị luyến và cộng sự hoàn thiện quy trình sản xuất chitin chitosan và chế biến một số sản phẩm công nghiệp từ phế liệu vỏ tôm cua báo cáo khoa học đề tài cấp bộ nha trang 2000nghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015