Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... haemagglutinin; HAI -1, hepatocyte growth factor activator inhibitor type 1; HAI-2, hepatocyte growth factor activator inhibitor type 2; HGF, hepatocyte growth factor; HGFA, hepatocyte growth factor activator; ... Nagatsuta,Midori-ku, Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroduction Type II transmembrane serine ... 257–2 61. 25 Miyazawa K, Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (19 89) Molecular cloning and sequence analysis of cDNA for...

Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf

... double stranded oligos Oct -1, 5¢-TGTCGAATGCAAATCACTAGAA-3¢; Sp1, 5¢-ATTCGATCGGGGCGGGGCGAGC-3¢; Ets/Pea3, 5¢-GATCTCGAGCAGGAAGTTCGA-3¢; Ets (PU .1) , 5¢-GGGCTGCTTGAGGAAGTATAAGAAT-3¢;Stat3,5¢-GATCCTTCTGGGAATTCCTAGATC-3¢; ... from a pM166 template using a common senseprimer 5¢-GAATAAGGAGGGCAGGGTGAA-3¢ (posi-tions )13 20 to )13 02 in GenBank accession no. AF025 817 ), and the antisense primers 5¢-TAGTGGGGAAAGAGTTGGAACG-3¢ ... TAC AGG AGG AGMu-S)97/) 91 GTG GCG TCT GAG GTA CCA ATG CAA ATG CGCMu-AS)97/) 91 GCG CAT TTG CAT TGG TAC CTC AGA CGC CACMu-S)87/)80 GAG ACT GTG ATG CGG TAC CTC CCG CCC TTT CMu-AS)87/)80 GAA AAG...

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep24, 10 73 11 09.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (19 85) For-oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... angiotensin-convertingenzyme, produced by actinomycetes. J Antibiot (Tokyo)38, 18 13 18 15.33 Aoyagi T, Wada T, Iinuma H, Ogawa K, Kojima F,Nagai M, Kuroda H, Obayashi A & Umezawa H (19 85) Inﬂuence of angiotensin-converting ... erythrochelin.Fig. S10. Fragmentation pattern of C-terminal fragment.Fig. S 11. LC-MS analysis of erythrochelin hydrolysate.Fig. S12. LC-MS trace of FDAA-derivatized standards.Fig. S13. LC-MS trace of FDAA-derivatized...

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... TransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori 1 , Johanna K. Ahlskog2, Lea Sistonen2 and Mikko Nikinmaa 1 1 Centre ... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT 14 0406080 10 0 12 0Counts ... hAutoradiographyAdd D beads and incubateD A O2Read AlphaLISA signal at 615 nmHSEFig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DNA binding activity. (A) Schematic presentation...

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... 15 Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,Hamasaki K et al. (2003) Interferon -a sensitizes humanhepatoma cells to TRAIL-induced apoptosis ... c release, mitochondrial membranedepolarization, caspase-3 activation, and Bax -a cleavageduring IFN -a- induced apoptosis in Daudi B lymphomacells. J Interferon Cytokine Res 20 , 11 21 11 29.45 ... Pokrovskaja K,Sangfelt O, Castro J, Einhorn S & Grande´r D (2002)Mechanisms of interferon-alpha induced apoptosis inmalignant cells. Oncogene 21 , 12 51 12 62.46 Saelens X, Kalai M & Vandenabeele...

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... template. PDE1(Arg189–Thr620) was ampliﬁed using theprimer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ ,and PDE1(Lys3 21 Thr620) was ampliﬁed ... 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. The resulting DNAfragments (1. 29 and 0.90 kbp) were digested with NdeI and XhoI and cloned ... isolation and analysis of drug-resistantmutants of a mammalian phosphodiesterase. Proc. Natl Acad. Sci.USA 90, 11 970 11 974.34. Boeke, J.D., Trueheart, J., Natsoulis, G. & Fink, G.R. (19 87)5-Fluoroorotic...

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... were analyzed and quantiﬁed on a Fuji Bio-Imaging analyzer BAS-2500 usingIMAGE GAUGEV3.3 software.Chromatin and protein–DNA analysisMicrococcal nuclease (MNase) digestion and in situ cleavage by ... Biotechnology) and acetylated H3 (Upstate Bio-technology), and antibodies against speciﬁc modiﬁcationssuch as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) and anti-H3 C-terminal (Abcam). ... revised 26 January 2004,accepted 30 January 2004)Eur. J. Biochem. 2 71, 11 53 11 62 (2004) Ó FEBS 2004 doi :10 .11 11/ j .14 32 -10 33.2004.04 019 .xgenes. The studies have revealed that both histone acetyl-transferases...

Tài liệu Báo cáo khoa học: Yeast glycogenin (Glg2p) produced in Escherichia coli is simultaneously glucosylated at two vicinal tyrosine residues but results in a reduced bacterial glycogen accumulation docx

... chromatogram, peaksin the original region (fractions 11 15 ; Fig. 3A) disappeared and new peaks (fraction 12 , 15 and 18 ; Fig. 3B) weredetected indicating that the amyloglucosidase treatment waseffective. ... a- amylasetreatment were separated by RP-HPLC (SMART system,Pharmacia, Uppsala, Sweden) on a Pharmacia C2/C18 SC2 .1/ 10 column using a linear 0–50% (v/v) acetonitrilegradient containing 0 .1% ... chemical clea-vage, the peptide mixture was incubated with a hydro lase(such as a- amylase) and was then separated by HPLC.Enzymatic deglucosylation was found to be essential asfragmentation...

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... Computational Linguistics, pages 12 10 12 19,Portland, Oregon, June 19 -24, 2 011 .c2 011 Association for Computational LinguisticsCreating a manually error-tagged and shallow-parsed learner corpusRyo ... NorthAmerican Chapter of the ACL, pages 15 4 16 2.Joel Tetreault, Elena Filatova, and Martin Chodorow.2 01 0a. Rethinking grammatical error annotation and evaluation with the Amazon Mechanical Turk. ... head words. In Proc. of Cognition and ExploratoryLearning in Digital Age, pages 18 4 19 1.Ryo Nagata, Takahiro Wakana, Fumito Masui, AtsuoKawai, and Naoki Isu. 2005. Detecting article...

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... ACL-HLT 2 011 System Demonstrations, pages 32–37,Portland, Oregon, USA, 21 June 2 011 .c2 011 Association for Computational LinguisticsMemeTube: A Sentiment-based Audiovisual System for Analyzing ... emoticons. This is similar to what many people have proposed for evaluation (Davidov et al. 2 010 ; Sun et al. 2 010 ; Bifet and Frank 2 010 ; Go et al. 2009; Pak and Paroubek 2 010 ; Chen et al. 2 010 ). ... February 7th 2 011 . The resulting video ex-presses negative valence and neutral arousal. After checking the posts, we have learned that it is be-cause the Japanese volcano Mount Asama has con-tinued...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien tai lieu bao cao thuc tap y si da khoa báo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptx tai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinh báo cáo khoa học về nghệ thuật trong lieu trai chi di tai lieu bao cao thuc tap tai khoa duoc benh vien hop luc đề tài báo cáo khoa học đề tài báo cáo khoa học sinh học Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ