Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt
... (IMMONC), Ricerca Sanitaria Finalizzata, Ricerca Sanitaria Applicata; Ribovax Biotechnologies (Geneva, Switzerland) and Fondazione Italiana Ricerca sul Cancro (FIRC). References 1 Pancholi V (2001) ... G, Giallongo A, Milella M et al. (2009) An integrated humoral and cellular response is elicited in pancreatic cancer by alpha-enolase, a novel pancreatic ductal adenocarcinoma-associated...
Ngày tải lên: 14/02/2014, 19:20
... name tagger based on co-training de- cays as the time gap between training data (seeds and unlabeled data) and test data increases (Mota and Grishman, 2008). Compared to the original classifier ... and has been extensively studied in NLP (Nigam and Ghani, 2000; Pierce and Cardie, 2001; Ng and Cardie, 2003; Mota and Grishman, 2008). In particular, we showed that the perfor- manc...
Ngày tải lên: 20/02/2014, 09:20
... inhibitor; HSA, human salivary a- amylase; LCAI, Lachrima jobi chitinase/ a- amylase inhibitor; PAI, pigeonpea a- amylase inhibitor; PPA, por- cine pancreatic a- amylase; RASI, rice a- amylase/subtilisin ... Brazil, Fax: + 5 5 6 1 340 3624, Tel.: + 55 61 448 4705, E-m ail: ocfranco@cenargen.embrapa.br Abbreviations: AAI, Amaranthus a- amylase inhibitor; a- AI1 and a- AI2, a- amylas...
Ngày tải lên: 21/02/2014, 03:20
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt
... genome databanks. Interestingly, this domain was found in some closely related bacterial species, but mainly in nonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase ... function in activity, substrate binding and structural dynamics. Materials and methods Experimental data The presence of a C-terminal putative binding domain in various animal ce...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases (...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and Mauro Fasano 1 1 Department of Structural and Functional Biology, and Centre of ... Journal compilation ª 2010 FEBS 4919 Proteomic analysis of dopamine and a- synuclein interplay in a cellular model of Parkinson’s disease pathogenesis Tiziana Alberio 1 , Alessandra...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolved in 10% methanol and analyzed ... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... factor. Thus, TransLISA can replace EMSAs and may be used in various applica- tions and research fields where quantitative, cost-effective and large-scale measuremen...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... WASP)-binding domain and a novel C-terminal actin-binding domain Thirumaran Thanabalu 1,2 , Rajamuthiah Rajmohan 2 , Lei Meng 2 , Gang Ren 4,5 , Parimala R. Vajjhala 4 and Alan L. Munn 1,3,4,6 * 1 ... polyclonal GFP-spe- cific antiserum was a gift from J. Kahana and P. Silver (Dana Farber Cancer Center, Boston, MA). The anti-actin mAb was MAB1501 from Chemicon International (Teme- cu...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis ... 40760–40767. 34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S (1999) TRAIL causes cleavage of bid by caspase-8 and loss of mitochondrial membrane potential resulting in apoptosis in BJ...
Ngày tải lên: 19/02/2014, 06:20