Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt

... (IMMONC), Ricerca SanitariaFinalizzata, Ricerca Sanitaria Applicata; RibovaxBiotechnologies (Geneva, Switzerland) and FondazioneItaliana Ricerca sul Cancro (FIRC).References1 Pancholi V (2001) ... G,Giallongo A, Milella M et al. (2009) An integratedhumoral and cellular response is elicited in pancreaticcancer by alpha-enolase, a novel pancreatic ductaladenocarcinoma-associated antigen. ... [107–115].Acetylation, methylation and phosphorylation arethe main PTMs (Table 2). Acetylation was found incervix and colon cancer, leukemia, normal pancreaticducts and tumoral pancreatic cells....

Tài liệu Báo cáo khoa học: "Updating a Name Tagger Using Contemporary Unlabeled Data" ppt

... name tagger based on co-training de-cays as the time gap between training data (seeds and unlabeled data) and test data increases (Mota and Grishman, 2008). Compared to the originalclassiﬁer ... and has been extensively studied inNLP (Nigam and Ghani, 2000; Pierce and Cardie,2001; Ng and Cardie, 2003; Mota and Grishman,2008). In particular, we showed that the perfor-mance of a name ... theunlabeled data backwards. The choice of ﬁxingthe test within the last epoch of the interval is theone that most approximates a real situation whereone has a tagger trained with old data and...

Tài liệu Báo cáo khoa học: Plant a-amylase inhibitors and their interaction with insect a-amylases ppt

... inhibitor;HSA, human salivary a- amylase; LCAI, Lachrima jobi chitinase/ a- amylase inhibitor; PAI, pigeonpea a- amylase inhibitor; PPA, por-cine pancreatic a- amylase; RASI, rice a- amylase/subtilisin ... Brazil, Fax: + 5 5 6 1 340 3624,Tel.: + 55 61 448 4705, E-m ail: ocfranco@cenargen.embrapa.brAbbreviations: AAI, Amaranthus a- amylase inhibitor; a- AI1 and a- AI2, a- amylase inhibitors 1 and 2 from ... bean; AMY1 and AMY2, a- amylases from barley seeds; BASI, barley a- amylasesubtilisin inhibitor; BLA, Bacillus licheniformis a- amylase; CAI,cowpea a- amylase inhibitor; CHFI, corn Hageman factor...

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... genomedatabanks. Interestingly, this domain was found insome closely related bacterial species, but mainly innonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase ... function in activity, substrate binding and structural dynamics.Materials and methodsExperimental dataThe presence of a C-terminal putative binding domain invarious animal cell extracts was checked ... Sequence data were depos-ited in GenBank (Table S1).Searches in databasesUsing the putative C-terminal domain of C. ﬂuminea as a query, sequence databases were searched by blastp and tblastn for...

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocytegrowth factor. ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally ... sets: 5¢-TCCCATCTGTAGCAGCAACT-3¢ and 5 ¢-GGATTTTCTGAATCGCACCT-3¢ forTMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢for HAI-1 (26 cycles). The GAPDH-speciﬁc...

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... Maria Bossi2, Alberto Milli2, Elisa Parma1, Marzia Bruna Gariboldi1,Giovanna Tosi3, Leonardo Lopiano4 and Mauro Fasano11 Department of Structural and Functional Biology, and Centre of ... Journal compilation ª 2010 FEBS 4919Proteomic analysis of dopamine and a- synuclein interplayin a cellular model of Parkinson’s disease pathogenesisTiziana Alberio1, Alessandra Maria Bossi2, ... substantia nigra pars compacta (SNpc) and depletion of striatal dopamine. Dopaminergic neuronaldeath is accompanied by the appearance of Lewybodies (LB), intracytoplasmic inclusions immunoreac-tive...

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For-oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... initiation- and cyclorelease-mechanisms.Abbreviations A, adenylation domain; ac-haOrn, a- N-acetly-d-N-acetyl-d-N-hydroxyornithine; C, condensation domain; CAS, chromazurol S;DKP, diketopiperazine;...

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... factor.Thus, TransLISA can replace EMSAs and may be used in various applica-tions and research ﬁelds where quantitative, cost-effective and large-scalemeasurements of the DNA-binding activity of transcription ... TransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2 and Mikko Nikinmaa11 Centre...

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... WASP)-binding domain and a novelC-terminal actin-binding domainThirumaran Thanabalu1,2, Rajamuthiah Rajmohan2, Lei Meng2, Gang Ren4,5, Parimala R. Vajjhala4 and Alan L. Munn1,3,4,6*1 ... polyclonal GFP-spe-ciﬁc antiserum was a gift from J. Kahana and P. Silver(Dana Farber Cancer Center, Boston, MA). The anti-actinmAb was MAB1501 from Chemicon International (Teme-cula, CA). The anti-hexokinase ... hand, and in corticalactin-patch polarization, on the other hand, are at leastpartially distinct [23]. However, there may still be a functional link between endocytosis and actin-patchpolarization....

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,Hamasaki K et al. (2003) Interferon -a sensitizes humanhepatoma cells to TRAIL-induced apoptosis ... 40760–40767.34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S(1999) TRAIL causes cleavage of bid by caspase-8 and loss of mitochondrial membrane potential resulting inapoptosis in BJAB cells. ... combination of IFNa and TRAIL,relative to TRAIL alone.In view of the cleavage of caspase substrates such asBID and PARP, the effect of IFNa and TRAIL onthe DNA content of MCF-7 cells was also assessed,using...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf tài liệu báo cáo thường niên công ty cổ phần kỹ nghệ đô thành pptx tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien tai lieu bao cao thuc tap y si da khoa báo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptx tai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinh báo cáo khoa học về nghệ thuật trong lieu trai chi di tai lieu bao cao thuc tap tai khoa duoc benh vien hop luc đề tài báo cáo khoa học Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ