Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... is an alternative isomerase in the retina of cone-dominant species, likely in retinal Mu ¨ ller cells [33,34]. In the present study, we report the clon ing and characte...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... protein kinase 1 (DAPK-1) is a Ca 2+ ⁄ calmodulin-regulated serine ⁄ threonine kinase composed of multiple functional domains, including a kinase domain, a calmodulin-binding domain, eight ankyrin ... occur in human cancers. To begin functional studies of s-DAPK-1, the s-DAPK-1 cDNA was cloned into a Flag–Myc vector (Fig. 2A) , which contains an N-terminal Flag tag and a C...

Ngày tải lên: 18/02/2014, 17:20

11 659 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... only lacks the conserved Na + binding site but also the essential negative charge (glutamate or aspartate) in transmembrane helix four as part of the ion-binding site. Therefore, the c ring of A. ... has only 10 membrane-buried negative charges that are essential for binding the ion and also for the rotational mechanism of the ring. The c ring of I. tartaricus has 1...

Ngày tải lên: 18/02/2014, 17:20

9 773 0
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... membrane, most of these mitochondrial pro- teins behave as if they have a- helical transmembrane domains, rather than b-barrels. These proteins are usually predicted to have a single a- helical transmembrane ... phase separation to be the most reliable means of purifying integral membrane proteins from the mitochondrial outer membrane, and of the 11 most abundant integral prot...

Ngày tải lên: 19/02/2014, 07:20

9 554 0
Tài liệu Báo cáo khoa học: "An alternative LR algorithm for TAGs" docx

Tài liệu Báo cáo khoa học: "An alternative LR algorithm for TAGs" docx

... substrings of stacks, and the symbol X to range over elements from A4 . A configuration (A, w) of the automaton con- sists of a stack A • $ and a remaining input w. The steps of the automaton are ... correctly. The language de- scribed by the grammar contains exactly the strings abc, a& apos;b'c ~, adbec, and a& apos;db'ecq The al- gorithm fro...

Ngày tải lên: 20/02/2014, 18:20

7 414 0
Tài liệu Báo cáo khoa học: "An Alternative Conception of Tree-Adjoining Derivation*" ppt

Tài liệu Báo cáo khoa học: "An Alternative Conception of Tree-Adjoining Derivation*" ppt

... taken full ad- vantage of this decoupling, and are not as appro- priate as they might be for the kind of further analysis that tree-adjoining analyses could make possible. In particular, the ... seen in that any adjunetion of/ 32 at a node at which an adjunction of/ 31 occurs could instead be replaced by an adjunction of/ 32 at the root of/ 31. The advantage...

Ngày tải lên: 20/02/2014, 21:20

10 338 0
Tài liệu Báo cáo khoa học: "An Open Source Toolkit for Phrase-based and Syntax-based Machine Translation" docx

Tài liệu Báo cáo khoa học: "An Open Source Toolkit for Phrase-based and Syntax-based Machine Translation" docx

... Linguistics NiuTrans: An Open Source Toolkit for Phrase-based and Syntax-based Machine Translation Tong Xiao †‡ , Jingbo Zhu †‡ , Hao Zhang † and Qiang Li † † Natural Language Processing Lab, Northeastern ... phrase-based and syntax-based machine translation. The toolkit supports several state -of -the- art models developed in statistical machine translation, including the...

Ngày tải lên: 19/02/2014, 20:20

6 531 0
Tài liệu Báo cáo khoa học: "An API for Measuring the Relatedness of Words in Wikipedia" docx

Tài liệu Báo cáo khoa học: "An API for Measuring the Relatedness of Words in Wikipedia" docx

... seman- tic relatedness of words in Wikipedia. 1 Introduction The last years have seen a large amount of work in Natural Language Processing (NLP) using measures of semantic similarity and relatedness. ... Italian Wikipedias and can be eas- ily extended to other languages 4 . 4 Software Architecture Wikipedia is freely available for download, and can be accessed using robust Open...

Ngày tải lên: 20/02/2014, 12:20

4 547 1
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... T-cell kinase (ITK) could in uence the infectivity of HIV and also have anti -in ammatory activity. Since 2006, several patients carry- ing a fusion protein, originating from a translocation joining ... directly involved in ligand binding, presumably abolishing the interaction with signaling partners. The remaining mutations alter amino acids located outside the ligand-bindin...

Ngày tải lên: 14/02/2014, 18:20

10 927 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

... 3B). Again, these changes were abol- ished in female db ⁄ db heart mitochondria. Together, these data suggest that the greater reliance of female murine cardiac mitochondria on glucose than on fatty acids ... (decrease in fatty acid utilization, increase in glucose utilization) in the murine female heart. Moreover, our data suggest that these changes occur in an Akt-independ...

Ngày tải lên: 18/02/2014, 16:20

7 582 0
w