0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... is an alternative isomerase in the retina of cone-dominant species, likely in retinal Mu¨ller cells [33,34]. In the present study, we report the clon ing and characterization of a novel isomerohydrolase ... subcellular fractionationTo analyze the cellular localization of zebrafishRPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the specificity of the antibody was...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... protein kinase 1 (DAPK-1) is a Ca2+⁄ calmodulin-regulated serine ⁄ threonine kinasecomposed of multiple functional domains, including a kinase domain, a calmodulin-binding domain, eightankyrin ... occur in human cancers.To begin functional studies of s-DAPK-1, the s-DAPK-1 cDNA was cloned into a Flag–Myc vector(Fig. 2A) , which contains an N-terminal Flag tag and a C-terminal Myc tag, and ... integrin-mediated polarity pathway.J Cell Biol 172, 619–631.10 Inbal B, Bialik S, Sabanay I, Shani G & Kimchi A (2002) DAP kinase and DRP-1 mediate membraneblebbing and the formation of...
  • 11
  • 659
  • 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... only lacks the conserved Na+binding sitebut also the essential negative charge (glutamate oraspartate) in transmembrane helix four as part of the ion-binding site. Therefore, the c ring of A. ... hasonly 10 membrane-buried negative charges that areessential for binding the ion and also for the rotationalmechanism of the ring. The c ring of I. tartaricus has11 negative charges that ... ion flow across the membrane[4–6].Subunit c of the F1F0ATP synthases has a molecularmass of approximately 8 kDa, and folds in the mem-brane like a hairpin, with two transmembrane helicesconnected...
  • 9
  • 773
  • 0
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... membrane, most of these mitochondrial pro-teins behave as if they have a- helical transmembrane domains, rather thanb-barrels. These proteins are usually predicted to have a single a- helicaltransmembrane ... phase separation to be the most reliablemeans of purifying integral membrane proteins from the mitochondrial outer membrane, and of the 11 mostabundant integral proteins, 10 had a- helical transmem-brane ... residues and a high abundance of aromatic residues that tend to be placed at the start of the strands [2,5]. These b-barrel proteinsare assembled in the bacterial outer membrane in a process mediated...
  • 9
  • 554
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "An alternative LR algorithm for TAGs" docx

... substrings of stacks, and the symbol X to range over elements from A4 . A configuration (A, w) of the automaton con- sists of a stack A • $ and a remaining input w. The steps of the automaton are ... correctly. The language de- scribed by the grammar contains exactly the strings abc, a& apos;b'c ~, adbec, and a& apos;db'ecq The al- gorithm from Schabes and Vijay-Shanker (1990) however also ... as the set of auxiliary trees that can be adjoined at N. This set may contain the element nil to indicate that adjunction at that node is not obligatory. An example of a TAG is given in...
  • 7
  • 413
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "An Alternative Conception of Tree-Adjoining Derivation*" ppt

... taken full ad- vantage of this decoupling, and are not as appro- priate as they might be for the kind of further analysis that tree-adjoining analyses could make possible. In particular, the ... seen in that any adjunetion of/ 32 at a node at which an adjunction of/ 31 occurs could instead be replaced by an adjunction of/ 32 at the root of/ 31. The advantage of this standard definition of ... recognition and parsing. 1 Introduction In a context-free grammar, the derivation of a string in the rewriting sense can be captured in a single canonical tree structure that abstracts all possible...
  • 10
  • 338
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "An Open Source Toolkit for Phrase-based and Syntax-based Machine Translation" docx

... LinguisticsNiuTrans: An Open Source Toolkit for Phrase-based and Syntax-based Machine Translation Tong Xiao†‡, Jingbo Zhu†‡, Hao Zhang† and Qiang Li† †Natural Language Processing Lab, Northeastern ... phrase-based and syntax-based machine translation. The toolkit supports several state -of -the- art models developed in statistical machine translation, including the phrase-based model, the ... proposed in (Chiang, 2007) and estimate the associated feature values as in the phrase-based system. For the syntax-based models, all non-terminals in translation rules are annotated with syntactic...
  • 6
  • 530
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "An API for Measuring the Relatedness of Words in Wikipedia" docx

... seman-tic relatedness of words in Wikipedia.1 Introduction The last years have seen a large amount of work in Natural Language Processing (NLP) using measures of semantic similarity and relatedness. ... Italian Wikipedias and can be eas-ily extended to other languages4.4 Software ArchitectureWikipedia is freely available for download, and canbe accessed using robust Open Source applications,e.g. ... Java and the Perl routines.5. Java wrapper library: provides a simple inter-face to create and access the encyclopedia pageobjects and compute the relatedness scores. The information flow of...
  • 4
  • 546
  • 1
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... T-cell kinase (ITK) could in uence the infectivity of HIVand also have anti -in ammatory activity. Since 2006, several patients carry-ing a fusion protein, originating from a translocation joining ... directly involved in ligandbinding, presumably abolishing the interaction withsignaling partners. The remaining mutations alteramino acids located outside the ligand-binding pocketand reduce ... 287–299.27 Plebani A, Soresina A, Rondelli R, Amato GM, AzzariC, Cardinale F, Cazzola G, Consolini R, De Mattia D,Dell’Erba G et al. (2002) Clinical, immunological, andmolecular analysis in a large...
  • 10
  • 926
  • 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

... 3B). Again, these changes were abol-ished in female db ⁄ db heart mitochondria. Together,these data suggest that the greater reliance of femalemurine cardiac mitochondria on glucose than on fattyacids ... (decrease in fatty acid utilization,increase in glucose utilization) in the murine femaleheart. Moreover, our data suggest that these changesoccur in an Akt-independent manner. Further studiesare ... mitochondrial fattyacid-transferring enzyme; MCAD, a representative fattyacid b-oxidation enzyme; PPARa, a key transcriptionalregulator of fatty acid genes; UCP3; the cardiac-enrichedGLUT4; and...
  • 7
  • 582
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vienBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM