Some studies on a probabilistic framework for finding object-oriented information in unstructured data
... studied in- detail the probabilistic framework for finding object-oriented information in unstructured data. It based on the domain-dependent features and machine learning for ranking object ... STUDIES ON A PROBABILISTIC FRAMEWORK FOR FINDING OBJECT-ORIENTED INFORMATION IN UNSTRUCTURED DATA UNDERGRADUATE THESIS Major: Infor...
Ngày tải lên: 23/11/2012, 15:04
Ngày tải lên: 01/11/2013, 07:20
... commercial marketing and to education and the force of law. Within this framework, the manager can consider variables relevant to the selection of education, marketing, and law as sets of tools that ... refers to as the 5Fs: facts (informational education), feelings (emotional education), facilitation (product, price, and place), freebies (promotions), and force (force of law). Hastings and...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI ... recombinant plasmid was transformed into BL21(DE3) pLysS cells and transformants were selected on LB agar plates containing 100 lgÆmL )1 of ampicillin. A single colony was picked and cultured...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: "A Pipeline Framework for Dependency Parsing" ppt
... are computed and search is called again. One interesting property of this framework is that it allows that use of future information in ad- dition to past information. The pipeline model nat- urally allows ... that a pair (a, b) will never be considered again given the same situation, that is, when there is no additional information about relations a or b participate in. Note th...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "A Unified Framework for Automatic Evaluation using N-gram Co-Occurrence Statistics" pptx
... according to the application being evaluated (Machine Translation, Automatic Summarization, and Automatic Question Answering) and the evaluation guidelines used by humans for evaluating such applications. ... 2.1 An Application Axis for Evaluation When trying to define what translating and summarizing means, one can arguably suggest that a translation is some “as-faithful-as-p...
Ngày tải lên: 20/02/2014, 16:20
Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc
... be formed. In case the source of the reparandum information gave a false alarm, the alternative of not skipping the reparandum is still available. For each utterance in the input, the parser ... work has proved adequate for a collection of human-human task-oriented dialogs, both in a full manual examination of the corpus, and in tests with a parser capable of parsing...
Ngày tải lên: 20/02/2014, 19:20
Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx
... complete formal paraphrase of (1) must include at least as much information as we have given above. In particular, the logical structure of our para- phrases contains essential information (about, ... that you will even be able to tell whether some semantic representation has a realisation as a natural language text at all. If we look again at the knowledge available to our...
Ngày tải lên: 22/02/2014, 10:20
Báo cáo khoa học: "A Probabilistic Model for Fine-Grained Expert Search" pptx
... serve as a reliable source connecting a topic and an expert candidate. We call the relation appearing in a special type of <Section> a special reference section relation. It might be argued ... distribution P(d) can be estimated based on static rank, e.g., PageRank (Brin and Page, 1998). P(q|d) can be estimated by using a standard language model for IR (Ponte and...
Ngày tải lên: 08/03/2014, 01:20
Báo cáo khoa học: "SenseRelate::TargetWord – A Generalized Framework for Word Sense Disambiguation" doc
... sequential sub-tasks or stages accepts data from a previous stage, per- forms a transformation on the data, and then passes on the processed data structures to the next stage in the pipeline. We have ... Proceedings of the ACL Interactive Poster and Demonstration Sessions, pages 73–76, Ann Arbor, June 2005. c 2005 Association for Computational Linguistics SenseRelate::Target...
Ngày tải lên: 08/03/2014, 04:22