Some studies on a probabilistic framework for finding object-oriented information in unstructured data

... studied in- detail the probabilistic framework for finding object-oriented information in unstructured data. It based on the domain-dependent features and machine learning for ranking object ... STUDIES ON A PROBABILISTIC FRAMEWORK FOR FINDING OBJECT-ORIENTED INFORMATION IN UNSTRUCTURED DATA UNDERGRADUATE THESIS Major: Information Technology Supervisor: Assoc. Prof. Dr. Ha Quang ... searching for object with focus on the probabilistic framework for finding object-oriented information in unstructured data. This chapter also gives their advantages and shortcoming in solving...

A general framework for studying class consciousness and class formation

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... commercial marketing and to education andthe force of law. Within this framework, the manager canconsider variables relevant to the selection of education,marketing, and law as sets of tools that ... refers to asthe 5Fs: facts (informational education), feelings(emotional education), facilitation (product, price, andplace), freebies (promotions), and force (force of law).Hastings and Elliott ... behaveresistant to behave education marketing law marketing, lawunable to behave unable to behave resistant to behave resistant to behave education, marketing, laweducation, marketing, laweducation,...

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI siteand an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI ... recombinant plasmid was transformed intoBL21(DE3) pLysS cells and transformants were selected on LB agar plates containing 100 lgÆmL)1of ampicillin. A single colony was picked and cultured in ... structureleading to domain swapping in Tt and Tm SurE. Theseor other interactions that impart a rigid structure arenot observed in Pa SurE.Intersubunit contactsSt SurE forms a strong domain-swapped...

Tài liệu Báo cáo khoa học: "A Pipeline Framework for Dependency Parsing" ppt

... arecomputed and search is called again.One interesting property of this framework isthat it allows that use of future information in ad-dition to past information. The pipeline model nat-urally allows ... that a pair (a, b) will neverbe considered again given the same situation, thatis, when there is no additional information aboutrelations a or b participate in. Note that if R or68L is taken, ... strong reason to useStep Back, since the classiﬁcation becomes moreaccurate – a more natural class of actions, with a smaller number of candidate actions.Once the parsing algorithm, along...

Tài liệu Báo cáo khoa học: "A Unified Framework for Automatic Evaluation using N-gram Co-Occurrence Statistics" pptx

... according to the application being evaluated (Machine Translation, Automatic Summarization, and Automatic Question Answering) and the evaluation guidelines used by humans for evaluating such applications. ... 2.1 An Application Axis for Evaluation When trying to define what translating and summarizing means, one can arguably suggest that a translation is some “as-faithful-as-possible” rendering ... evaluations, according to the application being evaluated (Machine Translation, Automatic Summarization, and Question Answering) and the guidelines used by humans when evaluating such applications....

Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc

... be formed. In case the source of the reparandum information gave a false alarm, the alternative of not skipping the reparandum is still available. For each utterance in the input, the parser ... work has proved adequate for a collection of human-human task-oriented dialogs, both in a full manual examination of the corpus, and in tests with a parser capable of parsing some of that corpus. ... correlate with planning difficultly. Clearly this is information that should be conveyed to higher-level reasoning processes. An additional advantage to mak- ing the parser aware of speech repairs...

Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

... complete formal paraphrase of (1) must include at least as much information as we have given above. In particular, the logical structure of our para- phrases contains essential information (about, ... that you will even be able to tell whether some semantic representation has a realisation as a natural language text at all. If we look again at the knowledge available to our "average ... turned into a meaningful sentence containing the word run, for instance. We can then start looking for phrase types and for relations between phrase types. We can perhaps be reasonably confident...

Báo cáo khoa học: "A Probabilistic Model for Fine-Grained Expert Search" pptx

... serve as a reliable source connecting a topic and an expert candidate. We call the relation appearing in a special type of <Section> a special reference section relation. It might be argued ... distribution P(d) can be estimated based on static rank, e.g., PageRank (Brin and Page, 1998). P(q|d) can be estimated by using a standard language model for IR (Ponte and Croft, 1998). In summary, ... build-ing (Craswell, 2001, Fu et al., 2007), data fusion (Maconald and Ounis, 2006), query expansion (Macdonald and Ounis, 2007), hierarchical lan-guage model (Petkova and Croft, 2006), and for- mal...

Báo cáo khoa học: "SenseRelate::TargetWord – A Generalized Framework for Word Sense Disambiguation" doc

... sequential sub-tasksor stages accepts data from a previous stage, per-forms a transformation on the data, and then passes on the processed data structures to the next stage in the pipeline. We have ... Proceedings of the ACL Interactive Poster and Demonstration Sessions,pages 73–76, Ann Arbor, June 2005.c2005 Association for Computational LinguisticsSenseRelate::TargetWord – A Generalized Framework for ... tothe package that allows a user to highlight a word in context to be disambiguated.3.1 Command LineThe command-line interface disamb.pl takes as inputaSENSEVAL-2 formatted lexical sample ﬁle....

Xem thêm