Tài liệu Báo cáo " Climate change adaptation from small and medium scale hydropower plants: A case study for Lao Cai province " doc
... climate change adaptation from small and medium scale hydropower plants in Lao Cai Province. Lao Cai is a mountainous province with high hydropower potential. Totally 116 small and medium hydropower ... VNU Journal of Science, Earth Sciences 27 (2011) 32-38 32 Climate change adaptation from small and medium scale hydropower plants:...
Ngày tải lên: 13/02/2014, 12:20
... are ambiguities arising from, for example, asparagine to aspartic acid, or glutamine to glutamic acid changes [14]. The a- conotoxins EpI, PnIA, GIC, GID, AnIA and AnIB contain pairs of asparagine ... conditions [5,36]. The anomalous chromatographic behaviour is seen particularly with a- CnIA, a- MI, a- GI and a- GID for both native and synthetic forms and persists even afte...
Ngày tải lên: 19/02/2014, 12:20
... Hà, tỉnh Lào Cai. - Rapid inventory technique in environmental control, WHO 1993; - Assessment of sources of air, water, and land Pollution - World Health Organization, Geneva, 1993. 3. PHƯƠNG ... góp ý kiến nhằm hoàn thiện báo cáo ĐTM. Bước 5: Bảo vệ trước hội đồng thẩm định báo cáo ĐTM c a tỉnh Lào Cai. Bước 6: Chỉnh s a, hoàn thiện báo cáo ĐTM theo kết luật c a Chủ tị...
Ngày tải lên: 26/02/2014, 04:20
Tài liệu Báo cáo " Eco-industrial park: from theory to practice Case study in Kinh Mon District, Hai Duong Province, Vietnam " doc
... and autumn are transition periods. Average temperature is 22.4 o C, average rainfall varies from 1,500 to 1,700 mm, and average annual sunshine is 1,700 hours, facilitate the tropical and ... projected area have been identified based on the analysed information regarding the local demands (i.e. Hai Duong thermal factory project area). Therefore, a chain of plants and factori...
Ngày tải lên: 13/02/2014, 12:20
Tài liệu Báo cáo khoa học: Substrate specificity and inhibition of brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola ppt
... canola (Bras- sica napus and Brassica rapa) and vegetables such ase cabbage (Brassica oleraceae var. capitata), cauliflower (B. oleraceae var. botrytis) and broccoli (B. oleraceae Keywords brassinin; ... brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola M. Soledade C. Pedras, Zoran Minic and Vijay K. Sarma-Mamillap...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... GTT ACT TCC GCA GCT AGG 466–483 Probe amplification for FISH RpCAbrF TAC AAG GAT GCC ATT AGC 613–630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839 RpCAtrFprobe TAC AAA GAT CCA ATC CAG C 616–634 RpCAtrRprobe ... Strongylocentrotus purpureus and F. scutaria larvae sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas, D. melanogaster-2 and D. melanogaster-3 sequences (data no...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Acetylcholinesterase from the invertebrate Ciona intestinalis is capable of assembling into asymmetric forms when co-expressed with vertebrate collagenic tail peptide doc
... was 0.17% for assays performed with cell extracts or media, and 0.085% for extracts of adults. ATCh and BTCh were used as substrates at various concentrations; for pharmaco- logical analyses and assays ... 2157–2167. 8 Satou Y, Yamada L, Mochizuki Y, Takatori N, Kawashima T, Sasaki A, Hamaguchi M, Awazu S, Yagi K, Sasakura Y et al. (2002) A cDNA resource from the basal chorda...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc
... and SAF84 in consideration of species recognition. Values are calculated for the N-terminal anti- bodies SAF34 and 8G8 for humans, SAF34, 8G8 and P4 for sheep, SAF34 and P4 for cattle, and SAF34 ... SAF34 for mice; and for the C-ter- minal antibodies 6H4, SAF60 and SAF70 for humans, and mAbs 6H4, SAF60, SAF70 and SAF84 for sheep, cattle and mouse. cbc bs cb...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt
... RT-PCR against the extracted RNA. (A) Lanes 1 and 2, total RNA extract. (B) Lane 1, nucleotide acid marker DL15000 (TaKaRa); Lane 2, FP subunit. (C) Lane 1, nucleotide acid marker DL2000 (TaKaRa); Lane ... Tsukihara T, Aoyama H, Yamashita E, Tomizaki T, Yamaguchi H, Shinzawa-Itoh K, Nakashima R, Yaono R & Yoshikawa S (1995) Structures of metal sites of oxidized bovine heart cytochrome c...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx
... 5¢-GGTTGCGCCATTGGCGCG GTTCCTGT TGACCTGCATATC-3¢;3¢-primer (R to V): 5¢-GATATG CAGGTC AACAGGAACCGCGCCAATGGCGCA ACC-3¢. The template used for amplification was the pKK233-2 plasmid containing Enterobacter ... conformational changes occurring upon ligand binding are accompanied by significant heat capacity changes. Determination of the heat capacity changes for the K22V, R120K and K22V/R120K...
Ngày tải lên: 19/02/2014, 13:20