Tài liệu Báo cáo " English - A global language and its implications for students " ppt

... explanations about how a language achieves a global status”. Some believe that easy grammar structures, familiarity in vocabulary, and the rich in culture. etc. make a global language and ... also claims that there are two main ways to make it possible to make a language global language . The first way is official way, that is, a language can be chosen to be used as “first language ... wide acceptance. In my writing, firstly, I will discuss about the term global language and how a ______ * Tel.: 8 4-4 -7 565992 E-mail: minhandnga@yahoo.com language becomes a global language. ...

Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx

... work.The ﬁrst type of data, called A- data, is a travel infor-mation data set harvested from the databases avail-able on the web, e.g., Wikipedia and Google Map. A- data consists of 1, 603 sentences ... of data, called Q-data, is theedited transcription of a speech data set simulatinghuman-computer dialogues in a lab environment. Q-data is intended for the system to learn to handle thevarious ... paper, a noise-robust dialogue act detectionusing named entity classes, partial sentence trees,derivation rules, and entropy-based dialogue act-derivation rule matrix is investigated. Data-drivendialogue...

Tài liệu Báo cáo khoa học: "NATURAL LANGUAGE AND COMPUTER INTEBFACE DESIGN MURRAY TUROFF DEPARTMENT OF COMPUTER AND IiVFORMATION SCIENCE IIEW JERSEY INSTITUTE OF TECHNOLOGY" ppt

... for any sor~ of natural language like interface. To the contrary, we have indirect empirical data that supports the premise that a natural language llke interface would be a disadvantage. For ... sure that given such a powerful capability, what a group of users would end up with would be very far from a natural language. The argument is sometimes made that a natural language interface ... who have a need to communicate quickly and accurately tend to develop a rather well specified subset of natural language that is highly coded and precise in nature. Pilots and po- lice are...

Tài liệu Báo cáo khoa học: "Combining Functionality and Object Orientedness for Natural Language Processing" ppt

... for manipulating data. Objects can be classified into classes and instances. A class defines a procedure [called a method) for handling incoming messages of its instances. A class inherits ... 'ease' and whose value is 'subject '. ; a variable rrteasage holds the value of an incoming message and a variable self points to the oSjeet itself. class he: if instantiated ... Lexical items with similar eharacterics can be grouped together as a class; we may, for example, have a class 'noun' as a superclass of lexicai items 'boy', 'girl',...

Tài liệu Báo cáo khoa học: "Word Vectors and Two Kinds of Similarity" pptx

... technique for automatic in-formation retrieval (Deerwester et al., 1990), butseveral studies (Landauer and Dumais, 1997) haveshown that LSA successfully mimics many hu-man behaviors associated ... comparisonamong four combinations of corpora and text units for the LSA-based and the cooccurrence-based861Table 1: Comparison of mean correct rate amongthe combinations of two corpora and ... and the word author aretaxonomically similar because they are synonyms,while the word writer and the word book are as-sociatively similar because they are associated byvirtue of an agent-subject...

Tài liệu Báo cáo khoa học: "Fast Decoding and Optimal Decoding for Machine Translation" doc

... California Stanford University4676 Admiralty Way, Suite 1001 Stanford, CA 94305Marina del Rey, CA 90292 jahr@cs.stanford.edugermann,knight,marcu,kyamada @isi.eduAbstract A good decoding algorithm ... pa-per, we compare the speed and out-put quality of a traditional stack-baseddecoding algorithm with two new de-coders: a fast greedy decoder and a slow but optimal decoder that treats de-coding ... to a human-judged transla-tion that transmits all of the meaning of the sourcesentence using ﬂawless target -language syntax.We have found it very useful to have several de-coders on hand....

Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt

... Ishida S, Inoue A, Kan Y &Yasumoto T (1995) Palytoxin analogs from the dino-ﬂagellate Ostreopsis siamensis. J Am Chem Soc 117,5389–5390.5 Taniyama S, Arakawa O, Terada M, Nishio S,Takatani ... MINIREVIEWMarine toxins and the cytoskeleton: a new view ofpalytoxin toxicityM. Carmen Louzao, Isabel R. Ares and Eva CagideDepartamento de Farmacologia, Facultad de Veterinaria, Universidad de Santiago ... TheNa+⁄ K+-ATPase has been proposed as receptor for palytoxin. The marinetoxin is known to act on the Na+pump and elicit an increase in Na+per-meability, which leads to depolarization and...

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... NatlAcad Sci USA 102, 4235–4239.33 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Katayama K & KuwadaM (1995) Isolation and characterization of a peptideisomerase ... M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but not syn-thetic ... China Sea. Sephadex G-25 was purchased fromAmersham Biosciences (Uppsala, Sweden), a ZORBAX300SB-C18 semipreparative column was from Agilent Tech-nologies (Santa Clara, CA, USA), and triﬂuoroacetic...

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan ... Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identiﬁca-tion and expression of a cDNA encoding human a- amino-b-carboxymuconate-e-semialdehyde decarboxy-lase ... fw, forward; rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR:...

Tài liệu Báo cáo khoa học: Guanidinium chloride- and urea-induced unfolding of FprA, a mycobacterium NADPH-ferredoxin reductase Stabilization of an apo-protein by GdmCl docx

... Guanidinium chloride- and urea-induced unfolding of FprA, a mycobacterium NADPH-ferredoxin reductaseStabilization of an apo-protein by GdmClNidhi Shukla1, Anant Narayan Bhatt1, Alessandro ... FprA and the 0.8 mCaCl2-stabilized apo-protein and analysed it by monit-oring the changes in tryptophan ﬂuorescence as sum-marized in Fig. 4A. For 0.8 m CaCl2-stabilized FprA, a sigmoidal ... GdmCl- and urea-induced changes in the structural and functionalproperties of FprA. Time-dependent changes in thestructural parameters and enzymatic activity of FprAat increasing GdmCl or urea...

Xem thêm