Fragile X Mutations Affect Boys and Their Grandfathers
13.5 Uniparental Disomy—A Double Dose from
One Parent
Too much genetic material. A piece of the short arm of Andre’s chromosome 10 (10 q − ) has moved to one chromosome 17. He is healthy. However, Esteban and Maribella have each inherited the copy of the chromosome 17 with the extra material (17 q + ) as well as two normal chromosome 10s. The extra chromosome 10 DNA caused their symptoms.
C H A P T E R
13
13.1 Portrait of a Chromosome
Mutations range from single-base changes to entire extra sets of chromosomes. A mutation is considered a chromosomal aber- ration if it is large enough to see with a light microscope using stains and/or fluorescent probes to highlight missing, extra, or moved genetic material.
In general, excess genetic material has milder effects on health than a deficit. Still, most large-scale chromosomal abnormalities present in all cells disrupt or halt prenatal devel- opment. As a result, only 0.65 percent of all newborns have chromosomal abnormalities that produce symptoms. An addi- tional 0.20 percent have chromosomal rearrangements in which chromosome parts have been flipped or swapped, but they do not produce symptoms unless they disrupt genes that are cru- cial to health.
Cytogenetics is the subdiscipline within genetics that links chromosome variations to specific traits, including ill- nesses. This chapter explores several chromosome–level abnor- malities and their effects on health. Actual cases are used to describe some of them.
Required Parts: Telomeres and Centromeres
A chromosome consists primarily of DNA and proteins with a small amount of RNA, and is duplicated and transmitted—
via mitosis or meiosis—to the next cell generation. Chromo- somes have long been described and distinguished by size and shape, using stains and dyes to contrast dark heterochromatin with the lighter euchromatin ( figure 13.1 ). Heterochromatin consists mostly of highly repetitive DNA sequences, whereas euchromatin has more protein-encoding sequences.
A chromosome must include structures that enable it to replicate and remain intact—everything else is essentially
informational cargo (protein-encoding genes and their controls).
The essential parts of a chromosome are:
■ telomeres
■ origin of replication sites, where replication forks begin
to form
■ the centromere
Recall from figure 2.18 that telomeres are chromosome tips.
In humans, each telomere is many repeats of the sequence TTAGGG. In most cell types, telomeres shorten with each mitotic cell division.
The centromere is the largest constriction of a chromo- some and it is where spindle fibers attach when the cell divides.
A chromosome without a centromere is no longer a chromo- some. It vanishes from the cell as soon as division begins because there is no way to attach to the spindle.
Centromeres, like chromosomes, are made up mostly of DNA and protein. Many of the hundreds of thousands of DNA bases that form the centromere are repeats of a specific 171-base DNA sequence. The size and number of repeats are similar in many species, although the sequence differs. This suggests that these repeats have a structural role in maintaining chromosomes rather than an informational role. Certain cen- tromere-associated proteins are synthesized only when mitosis is imminent, forming a structure called a kinetochore that con- tacts the spindle fibers, enabling the cell to divide.
Centromeres are replicated toward the end of S phase. A protein that may control their duplication is called centromere protein A, or CENP-A. Molecules of CENP-A stay with cen- tromeres as chromosomes are replicated, covering about half a million DNA base pairs. When the replicated (sister) chro- matids separate at anaphase, each member of the pair retains some CENP-A. The protein therefore passes to the next cell generation, but it is not DNA. This is another example of an epigenetic change.
Centromeres lie within vast stretches of heterochromatin.
The arms of the chromosome extend outward from the cen- tromere. Gradually, the DNA includes more protein-encoding sequences as distance from the centromere increases. Gene density varies greatly among chromosomes. Chromosome 21 is a gene “desert,” harboring a million-base stretch with no protein-encoding genes at all. Chromosome 22, in contrast, is a gene “jungle.” These two tiniest chromosomes are remark- ably similar in size, but chromosome 22 contains 545 genes to chromosome 21’s 225!
The chromosome parts that lie between protein-rich areas and the telomeres are termed subtelomeres ( figure 13.2 ). These areas extend from 8,000 to 300,000 bases inward toward the centromere from the telomeres. Subtelomeres include some protein-encoding genes and therefore bridge the gene-rich regions and the telomere repeats. The transition is gradual.
Areas of 50 to 250 bases, right next to the telomeres, consist of 6-base repeats, many of them very similar to the TTAGGG of the telomeres. Then, moving inward from the 6-base zone are many shorter repeats, each present in a few copies. Their
Figure 13.1 Portrait of a chromosome. Tightly wound, highly repetitive heterochromatin forms the centromere (the largest constriction) and the telomeres (the tips) of chromosomes.
Elsewhere, lighter-staining euchromatin includes many protein- encoding genes. The centromere divides this chromosome into a short arm (p) and a long arm (q). This chromosome is in the replicated form.
Centromere Sister chromatids
Euchromatin (light)
Heterochromatin (dark)
parm
qarm
Telomeres
Telomeres
The 24 human chromosome types are numbered from largest to smallest—1 to 22. The other two chromosomes are the X and the Y. Early attempts to size-order chromosomes resulted in generalized groupings because many of the chromosomes are of similar size. Use of dyes and stains made it easier to dis- tinguish chromosomes because they form patterns of bands.
Centromere position is one physical feature of chro- mosomes. A chromosome is metacentric if the centromere divides it into two arms of approximately equal length. It is submetacentric if the centromere establishes one long arm and one short arm, and acrocentric if it pinches off only a small amount of material toward one end ( figure 13.4 ). Some spe- cies have telocentric chromosomes that have only one arm, but humans do not. The long arm of a chromosome is designated q, and the short arm p ( p stands for “petite”).
Five human chromosomes (13, 14, 15, 21, and 22) have blob- like ends, called satellites, that extend from a thinner, stalklike bridge from the rest of the chromosome. The stalk regions do not bind stains well. The stalks carry many copies of genes encoding ribosomal RNA and ribosomal proteins. These areas coalesce to form the nucleolus, a structure in the nucleus where ribosomal building blocks are produced and assembled (see figure 2.3).
Karyotypes are useful at several levels. When a baby is born with the distinctive facial features of Down syndrome, a karyotype confirms the clinical diagnosis. Within families, function isn’t known. Finally the sequence diversifies and
protein-encoding genes appear.
At least 500 protein-encoding genes lie in the total sub- telomere regions. About half are members of multigene fami- lies (groups of genes of very similar sequence next to each other) that include pseudogenes. These multigene families may reflect recent evolution: Apes and chimps have only one or two genes for many of the large gene families in humans.
Such gene organization is one explanation for why our genome sequence is so very similar to that of our primate cousins—
but we are clearly different animals. Our genomes differ more in gene copy number and chromosomal organization than in DNA base sequence.
Karyotypes Chart Chromosomes
Even in this age of genomics, the standard chromosome chart, or karyotype, remains a major clinical tool. A karyotype dis- plays chromosomes in pairs by size and by physical landmarks that appear during mitotic metaphase, when DNA coils tightly.
Figure 13.3 shows a karyotype with an extra chromosome.
Figure 13.2 Subtelomeres. The repetitive sequence of a telomere gradually diversifies toward the centromere. The centromere is depicted as a buttonlike structure to more easily distinguish it, but it is composed of DNA like the rest of the chromosome.
Centromere Subtelomere
ACACACTTTCGCGAATAAT…TTAAGGTTAGGGTTAGGGTAAGGG…TTAGGGTTAGGG…
(Short repeats) (6-base repeats similar to telomeres) (Telomere) Telomere
Figure 13.3 A karyotype displays chromosome pairs in size order. Note the extra chromosome 21 that causes trisomy 21 Down syndrome.
Figure 13.4 Centromere position distinguishes
chromosomes. (a) A telocentric chromosome has the centromere toward one end although telomere DNA sequences are still at the tip. Humans do not have any telocentric chromosomes. (b) An acrocentric chromosome has the centromere near an end. (c) A submetacentric chromosome’s centromere creates a long arm (q) and a short arm (p). (d) A metacentric chromosome’s centromere establishes equal-sized arms.
Metacentric Submetacentric
Acrocentric Telocentric
a. b. c. d.
Replicated
centromere p
short arm q long arm
karyotypes are used to identify relatives with a particular chro- mosomal aberration that can affect health. In one family, sev- eral adults died from a rare form of kidney cancer. Karyotypes revealed that the affected individuals all had an exchange, called atranslocation, between chromosomes 3 and 8. When karyo- types showed that two healthy young family members had the translocation, physicians examined and monitored their kidneys.
Cancer was found very early and successfully treated.
Karyotypes of individuals from different populations can reveal the effects of environmental toxins, if abnormalities appear only in a group exposed to a particular contaminant.
Because chemicals and radiation that can cause cancer and birth defects often break chromosomes into fragments or rings, detecting this genetic damage can alert physicians to the pos- sibility that certain cancers may appear in the population.
Karyotypes compared among species can clarify evolu- tionary relationships. The more recent the divergence of two species from a common ancestor, the more closely related we presume they are, and the more alike their chromosome banding patterns should be. Our closest relative, according to karyotypes, is the pygmy chimpanzee (bonobo). The human karyotype is also remarkably similar to that of the domestic cat, and somewhat less similar to those of mice, pigs, and cows.
Among mammals, it is least like the karyotype of the aardvark, indicating that this is a primitive placental mammal.
collected from the inside of the cheek are the easiest to obtain for a chromosome test; white blood cells are used too. A per- son might require a chromosome test if he or she has a family history of a chromosomal abnormality or seeks medical help because of infertility.
Chromosome tests are commonly performed on cells from fetuses. Couples who receive a prenatal diagnosis of a chromosome abnormality can arrange for treatment of the newborn, if possible; learn more about the condition and con- tact support groups and plan care; or terminate the pregnancy.
These choices are best made after a genetic counselor or physi- cian provides information on the medical condition and treat- ment options.
Chromosomes of a fetus are checked in several ways.
Amniocentesis and chorionic villus sampling have been avail- able for many years. They sample fetal cells from the amniotic fluid and chorionic villi, respectively, and detect large-scale chromosomal abnormalities. A newer technique called chromo- some microarray analysis can be paired with the older tech- niques to detect copy number variants, which include extremely small sections of missing or extra DNA. Chromosome microar- ray analysis probes and displays specific sequences, detecting many disorders that other techniques miss.
Amniocentesis
The first fetal karyotype was constructed in 1966 using amnio- centesis. In this procedure, a doctor removes a small sample of fetal cells and fluids from the uterus with a needle passed through the woman’s abdominal wall ( figure 13.5a ). The cells are cultured for a week to 10 days, and typically 20 cells are karyotyped. The sampled amniotic fluid may also be examined for deficient, excess, or abnormal biochemicals that could indi- cate an inborn error of metabolism. Tests for specific single- gene disorders are based on family history and may be done on cells in the amniotic fluid sample as well. Ultrasound is used to follow the needle’s movement and to visualize fetal parts, such as the profile in figure 13.6 .
Amniocentesis can detect approximately 1,000 of the more than 5,000 known chromosomal and biochemical prob- lems. The most common chromosomal abnormality detected is one extra chromosome, called a trisomy. Amniocentesis is usually performed between 14 and 16 weeks gestation, when the fetus isn’t yet very large but amniotic fluid is plentiful.
Amniocentesis can be carried out anytime after this point.
Doctors recommend amniocentesis if the risk that the fetus has a detectable condition exceeds the risk that the proce- dure will cause a miscarriage. Until recently, this risk cutoff was thought to be about age 35 in the woman, when the risk to the fetus of a detectable chromosome problem about equals the risk of amniocentesis causing pregnancy loss—1 in 350. While it is still true that the risk of a chromosomal problem rises steeply after maternal age 35, amniocentesis has become much safer in the 30 or so years since the statistics were obtained that have been used for most risk estimates ( figure 13.7 ). In 2007 a large study found the risk of amniocentesis causing miscarriage to be about 1 in 1,600, leading some physicians and organizations
Key Concepts
1. A chromosome minimally includes telomeres, origins of replication, and centromeres.
2. A centromere consists of DNA repeats and associated proteins, some of which bind spindle fibers. Centromere protein A enables the centromere to replicate.
3. Subtelomeres contain telomerelike repeats and protein- encoding multigene families.
4. Chromosomes differ by size, centromere location, satellites, and staining. Karyotypes are size-order chromosome charts.
13.2 Visualizing Chromosomes
Extra or missing chromosomes are detected by counting a num- ber other than 46. Identifying chromosome rearrangements, such as an inverted sequence or an exchange of parts between two chromosomes, requires a way to distinguish among the chromosomes. A combination of stains and DNA probes applied to chromosomes allows this. A DNA probe is a labeled piece of DNA that binds to its complementary base sequence on a par- ticular chromosome.
Obtaining Cells for Chromosome Study
Any cell other than a mature red blood cell (which lacks a nucleus) can be used to examine chromosomes, but some cells are easier to obtain and culture than others. Skinlike cells
the more invasive amniocentesis and chorionic villus sampling, which yield a definitive diagnosis. Screening tests consider maternal age, ultrasound findings, and levels of certain pro- teins in the woman’s blood at certain times in the pregnancy.
Chorionic Villus Sampling
During the 10th through 12th week of pregnancy, chorionic villus sampling (CVS) obtains cells from the chorionic villi, which are finger-like structures that develop into the placenta ( figure 13.5 b ). A karyotype is prepared directly from the col- lected cells, rather than first culturing them, as in amniocente- sis. Results are ready in days.
Because chorionic villus cells descend from the fertil- ized ovum, their chromosomes should be identical to those of the embryo and fetus. Occasionally, a chromosomal aberration
to offer amniocentesis to younger women too. The procedure is also warranted if a couple has had several spontaneous abor- tions or children with birth defects or a known chromosome abnormality, irrespective of maternal age.
Another reason to seek amniocentesis is if screening tests on a pregnant woman indicate elevated risk for a trisomy (extra chromosome) of the fetus. These “multiple maternal serum marker” tests, discussed in Bioethics: Choices for the Future on page 245, are offered to all pregnant women. Cut-off levels for the results based on population statistics are used to iden- tify fetuses at elevated risk, and the women are then offered
Figure 13.5 Three ways to check a fetus’s chromosomes.
(a) Amniocentesis draws out amniotic fluid. Fetal cells shed into the fluid are collected and their chromosomes examined.
(b) Chorionic villus sampling removes cells that would otherwise develop into the placenta. Since these cells descended from the fertilized ovum, they should have the same chromosomal constitution as the fetus. (c) Researchers can detect fetal cells, DNA, or mRNA in a sample of blood from a pregnant woman.
a. Amniocentesis
b. Chorionic villus sampling
c. Fetal cell sorting Fetus
15 –16 weeks
Fetal cells suspended in the fluid around the fetus are sampled.
Cells of the chorion are sampled.
Fetal cells in maternal blood- stream are sampled.
Figure 13.6 A sonogram is an image obtained with ultrasound. In an ultrasound exam, sound waves bounced off the embryo or fetus are converted into a three-dimensional-appearing image. “4D ultrasound” provides a video of an embryo or fetus.
(The fourth dimension is time.)
Figure 13.7 The risk of conceiving an offspring with trisomy 21 rises dramatically with maternal age.
Maternal age (years)
Frequency
1:50
1:100
1:500
1:1000 20
Trisomy 21 in liveborn infants
25 30 35 40 45
Prenatal tests for trisomy 21 Down syndrome are of two general types. Screening tests identify fetuses that are at increased risk of having trisomy 21. These tests consider an ultrasound finding (excess fluid at the back of the neck) and abnormal levels of certain proteins in the pregnant woman’s blood (multiple maternal serum markers) and maternal age. (table 1). Screening tests that include serum markers are routinely offered to pregnant women of any age, and much more accurately predict risk than maternal age alone.
If screening tests find a fetus to be at elevated risk for trisomy 21, more invasive diagnostic tests are offered—chorionic villus sampling or amniocentesis. Both are highly accurate, but introduce a small risk of miscarriage. In contrast to the screening tests, the diagnostic tests actually visualize the extra chromosome.
In 2004, the government of Denmark issued new guidelines offering prenatal screening for trisomy 21 to all pregnant women.
Earlier guidelines offered diagnostic tests only to women over age 35, based on assessment by age alone and using old statistics. Informed consent was required—that is, all women who took the screening tests knew the risks and benefits.
Researchers have tracked number of trisomy 21 births and use of diagnostic testing (CVS and amniocentesis) in Denmark
from 2000 until 2006 to assess impact of the new guidelines. The number of infants born with trisomy 21 has been halved, the number diagnosed before birth increased by 30 percent, and the number of invasive prenatal diagnostic tests done each year has decreased by 50 percent.
Health care is nationalized in Denmark, and prenatal screening for trisomy 21 is available to all. In addition, all of the nation’s nineteen departments of obstetrics and gynecology use the same software for their record keeping, so that it is easy to maintain national databases of test results and clinical outcomes. Studies are ongoing to assess the societal and bioethical repercussions from implementing the new guidelines.
Questions for Discussion
1. What is a medical benefit of the guidelines in Denmark?
2. What do you think potential patients should be told during the informed consent process?
3. Mark Leach, chairman of the Down Syndrome Affiliates in Action group, said that testing has “outpaced society’s understanding of what life with Down syndrome is like.” How would you feel about the program if you had a child with Down syndrome?
4. How can the Danish government prevent women from feeling pressured to have prenatal testing for trisomy 21?
5. Explain how the number of infants born with Down syndrome declined more than half, but additional prenatal diagnosis increased only by about a third.
6. Down syndrome patients are living longer and richer lives than they have in the past. How can this fact be reconciled with a population-wide screening program such as the one in Denmark?
7. What should the role of the father be in deciding whether a woman should have prenatal screening or diagnosis for trisomy 21?
Bioethics: Choices for the Future
The Denmark Study: Screening for Down Syndrome
Marker Elevated Risk
Alpha fetoprotein (AFP) < normal
Human chorionic gonadotropin (hCG) > normal
Estriol < normal
Inhibin A > normal
Pregnancy-associated plasma protein A < normal
Table 1 Commonly Used Maternal Serum Markers
occurs only in a cell of the embryo, or only in a chorionic villus cell. This results in chromosomal mosaicism—the karyotype of a villus cell differs from that of an embryo cell. Chromo- somal mosaicism has great clinical consequences. If CVS indi- cates an abnormality in villus cells that is not also in the fetus, then a couple may elect to terminate the pregnancy when the fetus is actually chromosomally normal. In the opposite situ- ation, the results of the CVS may be normal, but the fetus has abnormal chromosomes.
CVS is slightly less accurate than amniocentesis, and in about 1 in 1,000 to 3,000 procedures, it halts development of the feet and/or hands, a condition termed transverse limb defects. Also, CVS does not sample amniotic fluid, so tests for
inborn errors of metabolism are not possible. The advantage of CVS is earlier results, but the disadvantage is a greater risk of spontaneous abortion. However, CVS has become much safer in recent years.
Fetal Cells, DNA, and RNA
Detecting fetal cells or nucleic acids in the pregnant woman’s bloodstream is safer than amniocentesis and CVS, but is still experimental in the United States ( figure 13.5 c ). The technique traces its roots to 1957, when a pregnant woman died when cells from a very early embryo lodged in a major blood vessel in her lung, blocking blood flow. The fetal cells were detectable because