α stimulation is also not regulated at the protein translational level
Investigation of complement protein c1q implications for its protective roles against systemic lupus erythematosus
Ngày tải lên :
11/09/2015, 10:05
... protein by chronic IFN -α stimulation does not occur at the transcriptional level 111 5.6 The downregulation of C1q after chronic IFN -α stimulation is also not regulated at the protein ... (antibodymediated) pathway, the mannose binding lectin (MBL) pathway, and the alternative pathway Although each pathway has a unique combination of initiating proteins, all three converge in the activation ... phosphorylation of IFNAR1, Stat1 and Stat2 Stat1 could homodimerize to form the IFN -α- activated factor (AAF) or IFNstimulated gene factor (ISGF3) which is a heterotrimeric complex of Stat1, Stat2 and...
- 207
- 425
- 0
Báo cáo hóa học: " Stretching and immobilization of DNA for studies of protein–DNA interactions at the single-molecule level" ppt
Ngày tải lên :
22/06/2014, 18:20
... decrease in the replication rate when the force exceeds pN The decrease in the replication rate is attributed to the work that DNAP has to perform against the external load to contract the template in ... pushes the particle back into the center of focus of the beam Hence the particle is trapped at the focal point of the laser, and the relationship between the displacement of the particle from the ... generated by the continued twisting of the DNA (Fig 6B) As topo II is added to the system at low ATP concentration, the stepwise DNA extension by 2d can be observed each cycle in which the protein...
- 17
- 351
- 0
A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
Ngày tải lên :
07/09/2013, 13:02
... presentations” The more they participate, the more they speak and the more they speak, the more fluent they become in English In short, most of the students responded that they found satisfied when they ... but they are not told the precise purpose They are all assured that the information collected will not be used towards their course grades It is important for them because a non-threatening atmosphere ... BUT THEY ARE NOT TOLD THE PRECISE PURPOSE THEY ARE ALL ASSURED THAT THE INFORMATION COLLECTED WILL NOT BE USED TOWARDS THEIR COURSE GRADES IT IS IMPORTANT FOR THEM BECAUSE A NON-THREATENING ATMOSPHERE...
- 77
- 890
- 5
Slide a study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
Ngày tải lên :
29/01/2014, 10:33
... of the study Qualitative : - Observation - Questionnaire Quantitative: - Descriptive statistics Subjects of the study 16 post-elementary non major students all of them learned English ... Records: All the group discussions and the individual presentations from No planning group & Pre-planning group Group Data Analysis Language Related Episodes Form-based LREs (F - LREs) Lexis-based ... Relationship between group work and individual presentation Objectives of the study contribute more theory to the understandings of group discussion find out the essentials of group discussion...
- 15
- 798
- 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
Ngày tải lên :
06/03/2014, 01:20
... the translated genes (data not shown) Also, the efficiency of different tRNA synthetases and the 3D structure of the translated mRNA may effect the translation efficacy These conclusions were also ... indicates that the translation efficiency of the SD sequence included in the T7 promoter is no higher than for the other vectors One explanation for this could be that the T7-driven transcription is ... features of the translated protein The differences in the fractions of soluble protein achieved for the different proteins could, in most cases, also be correlated with the solubility of the protein...
- 11
- 445
- 0
WORKING PAPER NO. 136 RETAIL BANK INTEREST RATE PASS-THROUGH: NEW EVIDENCE AT THE EURO AREA LEVEL docx
Ngày tải lên :
15/03/2014, 14:20
... administrated to be zero Turning to Chart 1b, the maturity of the instruments also plays prima facie a role in determining the level of bank lending rates: the lower the maturity the higher the level ... deposits the lower the deposit rate The interest rate on overnight deposits is also low compared to other bank deposit rates, partially due to the fact that in France and Ireland this deposit rate is ... that is the bank interest rate, is a constant markup and mr is the marginal cost price approximated by a comparable market interest rate The underlying idea is that market interest rates are the...
- 43
- 711
- 0
TEACHING WRITING USING PICTURE STORIES AS TOOLS AT THE HIGH SCHOOL LEVEL: THE MOVEMENT FROM OTHER REGULATION TO SELF REGULATION doc
Ngày tải lên :
24/03/2014, 19:20
... college level, where the medium of instruction is mother tongue (L1), is that the basic standard of learners in English is not upto the expected level On an average, their achievement level is a matter ... briefly discussed This chapter also contains the research hypothesis, the assumptions on which the study is based, the significance and scope of the study Finally, a brief outline of the dissertation ... Tools at the High School Level: The Movement from Other Regulation to Self-Regulation – M.Phil Dissertation 18 English is important because it has become the ‘linguistic tool’ permeating...
- 261
- 641
- 1
báo cáo hóa học:" Health status in routine clinical practice: validity of the clinical COPD questionnaire at the individual patient level" potx
Ngày tải lên :
20/06/2014, 15:20
... pulmonary diseases The clinicians were instructed to complete the CCQ of a patient the way they thought the patient should have rated the CCQ, based on the patient characteristics and interview This ... the patient’s scores) completed the CCQ as he thought the patient should have completed the CCQ After the consultation, patients performed the 6-min walking distance test One of the investigators ... as there is no trend visible The Blant and Altman plots of the separate domains show more deviation from the origin than the total score, where the functional status and mental state have the...
- 7
- 370
- 0
Nationality and international innovation management a cross national study at the MNC subsidiary level
Ngày tải lên :
26/11/2015, 22:49
... understanding what affects MNC innovation management behavior Most of the research has investigated this strategically important issue at the national or corporate level; however, few look at this issue ... Considerable attention has been paid to innovation management at the national level, for example, national innovation systems (NIS), as well as at the corporate level, of which multi-national corporations ... innovation management at the macro level as above-mentioned, few studies have fully explored this issue at less macro level such as at the subsidiary level This study attempts to combine the NIS...
- 129
- 305
- 0
báo cáo khoa học: " The Arabidopsis translocator protein (AtTSPO) is regulated at multiple levels in response to salt stress and perturbations in tetrapyrrole metabolism" potx
Ngày tải lên :
11/08/2014, 11:21
... (Figure 8A and not shown) These results indicate that AtTSPO accumulation is regulated at the transcriptional, post-transcriptional and post -translational levels To confirm the location of AtTSPO we ... synthesis, suggesting that disturbances in tetrapyrrole biosynthesis or accumulation affect AtTSPO mRNA expression AtTSPO localization depends on the translational start site used AtTSPO (At2 g47770) ... chloroplasts and the ER [50], as well as between mitochondria and the nucleus [51], corroborates this hypothesis At the present moment it is not clear which pathway is used during AtTSPO relocation during...
- 17
- 368
- 0
Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx
Ngày tải lên :
18/02/2014, 13:20
... within the cell We found this translocation to be dependent on the final amino acids of the receptor protein Similar to the other PDZ domain interactions that have been shown to be abolished by mutating ... revealed that the association of hOR2AG1 with MUPP1 regulates signal duration To a certain extent, the impaired signal desensitization resembles the effect of the absence of the multi-PDZ domain protein ... prolong the duration of GABAB receptor signaling and increase the stability of the receptor [19] However, we must note that the situation in the recombinant expression system is different from that...
- 12
- 543
- 0
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
Ngày tải lên :
21/02/2014, 00:20
... interior of the protein matrix The script a is the peak–peak distance between the maximum at %287 nm and the minimum at %283 nm, and the script b is the peak–peak distance between the maximum at %295 ... that cannot be penetrated by cationic quenchers The tryptophan residue in the model of PsbQ protein is at the start of helix-2, pointing towards the core of the protein (Fig 5C) This position is ... maximum at %323 nm at 20 °C The normalization at 400 nm [66] of the two spectra of PsbQ, seen at 295 and 280 nm, shows that the fluorescence emission caused by tyrosine is weak This suggests that there...
- 12
- 550
- 0
Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt
Ngày tải lên :
16/03/2014, 13:20
... created at the N-terminus of human MPP3 by annealing the following primers: 5¢-GACT ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG ... allowing their intermolecular binding This mediator might be missing in the retina or is competed out by another protein that does not facilitate the binding of Mpp3 and Mpp4 Alternatively, Mpp3 ... full-length MPP3 protein, the other a protein truncated after the SH3 domain (MPP3DGuK) The latter transcript was more abundant, but we did not detect MPP3DGuK protein in the retina The mRNA or the resulting...
- 14
- 449
- 0
báo cáo hóa học: " Astrocyte production of the chemokine macrophage inflammatory protein-2 is inhibited by the spice principle curcumin at the level of gene transcription" pptx
Ngày tải lên :
19/06/2014, 22:20
... and NF-IL-6 cis-acting elements demonstrate that inhibition of MIP-2 by curcumin occurs at the level of gene transcription The importance of either of these elements in the regulation of inducible ... bacterial meningitis, neutralization of MIP-2 with a monoclonal antibody attenuated infiltration of the CNS with PMNs[11] The origin of MIP-2 in inflammatory CNS disorders has not been fully defined, ... MIP-2 is a dominant, driving force in the pathogenesis of many CNS disorders that are associated with infiltration of neutrophils in the brain[9,10] Experimentally, recruitment of neutrophils to the...
- 7
- 385
- 1
Báo cáo khoa học: "Serum estradiol should be monitored not only during the peri-menopausal period but also the post-menopausal period at the time of aromatase inhibitor administration" pdf
Ngày tải lên :
09/08/2014, 04:21
... precise evidence about treatment of the relapse date the treatment began and ended, form of the treatment; outcome of the treatment (alive and disease free, alive with disease, dead); date of death; ... clearly indicates the existence of distant metastases in these patients at the time of the operation, thus supporting the evidence of distant metastases at the moment of operation as one of major ... initiation of treatment Our hypothesis was that the reason for treatment failure in many operated patients, independently of the way of preoperative mediastinal assessment, could be the existence...
- 11
- 332
- 0
Báo cáo khoa học: "Serum estradiol should be monitored not only during the peri-menopausal period but also the post-menopausal period at the time of aromatase inhibitor administration" pps
Ngày tải lên :
09/08/2014, 04:21
... with this ECLIA assay We also did not investigate the precision of the ECLIA method However, it is at least clear that in these patients the reduction of E2 that can be expected due to the effects ... clinical studies of AIs did not show any patients in whom the AI administration led to renewed elevation of E2 [1316] We assume that the reason for this is that most of the patients enrolled in ... of the patients in this study who showed renewed elevation of serum E2 had not undergone any prior therapy and were administered only the AI, and the results indicate the possibility that they...
- 5
- 281
- 0
báo cáo khoa học: " Awareness of the need for safe storage of Methadone at home is not improved by the use of protocols on recording information giving" doc
Ngày tải lên :
11/08/2014, 18:20
... for the patient group IBC supervised the data analysis, co- supervised AM during the project and during the preparation of the initial draft manuscript RNB conceived of the audit, devised the ... shows the responses reported by the patients who selected their storage location as 'other' If a patient responded that they stored their methadone in a cupboard or cabinet, they were then asked the ... analysed the data and wrote the initial draft of the manuscript RJM supervised the data collection and facilitated access to the patients DJW provided clinical supervision to AM and is the responsible...
- 6
- 383
- 0
Besides increasing the number of universities,rasing the education quality is also urgent problem
Ngày tải lên :
19/07/2013, 16:34
... facilities for them Also this school year, the ministry will continue campaigning against examination cheats If untoward behaviour is found in any locality, the cheaters will be publicised nationwide ... Communication Technology (ICT) on education and administration management as part of Decree 64, which was issued by the Government last year Candidates attend the National Non-professional Information ... departments across the country so that attendees would not need to host other meetings to disseminate information to their staff, said Quach Tuan Ngoc, head of the Department of Information 11 and...
- 21
- 427
- 0
Tài liệu In this lab, 2 ISDN routers are required. If ISDN routers are not available, review the lab to become familiar with the process. An Adtran Atlas550 ISDN emulator is used to simulate the switch/ISDN cloud. pdf
Ngày tải lên :
21/12/2013, 19:15
... j Use the show interface command and note that the output shows that the interface is spoofing This provides a mechanism for the interface to simulate an active state for internal ... interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for the possible combinations of ... Please refer to the chart at the end of the lab to correctly identify the interface identifiers to be used based on the equipment in the lab The configuration output used in this lab is produced...
- 8
- 419
- 0
Tài liệu The life is at the end of the road doc
Ngày tải lên :
25/01/2014, 09:20
... The life is at the end of the road 2010 so sánh số với nước láng giềng Campuchia có 6%, Lào có 13% Thái Lan 9% Theo GS TS Lê Đình Quang, viện nghên cứu ... hứng gió rôto [m2] ρV3 [W/m2] Công suất trục rôto tính theo công thức: P = Think green and action green Page 2 The life is at the end of the road 2010 Một số lưu ý lắp đặt tua bin gió Nói ... thiết kế cho nhà rẻ b ó máy phát điện NLG tùy theo nhu cầu s dụng y n G sử Thin nk green an nd action gr reen Pa age 4 The life is at the end of the road 2010 Các bước để thiết kế hệ thống...
- 8
- 495
- 0