zap 70 expression by cll and t cells

... compared to patients identified as ZAP- 70 positive by the ISO- or the T- methods but not by the T/ B Ratio-method (30 cases; Fig 3B) ZAP- 70 expression according to the ISO-, T- and T/ B Ratio-methods: ... estimate the optimal cut-off capable to split patients into groups with different time to treatment (TTT) probabilities applied to ZAP- 70 expression values determined according to T/ B Ratio-method ... was evaluated with the T- method utilizing the standard cutoff of 20% positive cells, as well as with the T/ B Ratiomethod; in the latter case, the cut-off of 3.0 identified in the test set was chosen...

Ngày tải lên: 18/06/2014, 16:20

... 5'-CGCCTACCTCAGGCTTATCTC-3' R: 5'-CCTCGACAGTCAGGCAGTC-3' F: 5'-TGGGGGACCCAGAGATTAAAA-3' R: 5'-TTTCGTCCATAGGAGACAATGC-3' F: 5'-TCAATGAAACTGGGCTGTACTTT-3' R: 5'-AGAGTTCCTCATGTAGACCTTGT-3' 101 bp ... (data not shown) Total RNA was extracted from CD8+/CD16- T lymphocytes Analyses were done to ensure that the magnetic cells sorting (MACS) and binding of CD8 antigen did not activate the CD8+ T ... apoptotic index of their alveolar cells Chrysofakis et al [8] were able to document that perforin expression, a cytotoxic and activation marker, and cytotoxic activity of CD8+ T lymphocytes in the...

Ngày tải lên: 12/08/2014, 15:21

... compared to stimulation with an encapsulated strain Together these data clearly demonstrate that airway epithelial cells mount a strong inflammatory response to C neoformans that is modulated by the ... respectively This modest inflammatory activation of the airway epithelium is consistent with the subtle clinical manifestations that are characteristic of cryptococcal respiratory tract infection ... [12,27] The current study has shown that the interaction of C neoformans with bronchial epithelial cells activates the expression of both transcription factors and chemokines that have well-established...

Ngày tải lên: 12/08/2014, 15:21

... assess and compare the activity and toxicity of novel tetradentate and hexadentate pyridinones with bidentate DFP, whose toxicity may be due to the transient formation of reactive ligand-Fe species ... approximately 10% of the total Fe uptake at h in both the hepatocytes and hepatoma cells There was a marked difference in NTBI uptake between the two cell types, with hepatocytes internalizing ... in hepatoma cells at the same concentration The tetradentate molecule, 5L1O, was also active, decreasing uptake to about 10% of the control in both cell types Kinetics of NTBI uptake in the presence...

Ngày tải lên: 20/02/2014, 11:20

... the expression of the protein in both tissues to such an extent that it was easily detected by enzyme-linked immunohistochemistry In the small intestine, the cytoplasm or the reticular structure ... might have been mistargeted to the cytoplasm In regard to this, it is of interest to point out the recent publication by Fujimoto et al [10], showing that 17b-HSD11 was identified as the third ... in extrahepatic tissues The intestine-type FABP gene is another exception, because it responds to the PPARa ligand better in the intestine than in the liver, although the induction ratio in the...

Ngày tải lên: 07/03/2014, 05:20

... online http://arthritis-research.com/content/5/6/288 cent to the cartilage pannus junction, where they may be associated with cytokine expression [11,12] Their potential effector function includes ... position in effector mediator pathways to provide a therapeutic target, given the multiplicity of other chemokines present in synovial tissues to which synovial T cells and indeed other leukocyte ... promote host tissue inflammatory damage The data from Ott and colleagues [9] now suggest that mast cells could significantly modify T- cell function not only through chemokine release but also...

Ngày tải lên: 09/08/2014, 01:23

... T cells by using a T cell line reactive with the major CII epitope 260– 270 but with oligoclonal reactivity to the various post-translational modifications As expected, these T cells could not ... (Figs and 2) The strongest reactivity was seen to the galactosylated peptide, but the hydroxylated peptide also mounted a strong response Interestingly, the T cell line cross-reacted to the glycosylated ... & Therapy Vol No Nandakumar et al Results Figure (a) B KO T KO B KO + T KO Antibody-mediated arthritis in mice deficient in B and/ or T cells WT To understand the role of B and T cells in antibody-mediated...

Ngày tải lên: 09/08/2014, 01:24

... with healthy controls Terminally differentiated effector CD8 T cells (CD45RA+CD27-) from both CHB patients and healthy controls expressed little CD127, as indicated in Fig 1b To determine whether ... T cells after successful antiviral treatment We compared the expression of CD127 on HBV-specific CD8+ T cells from CHB patients before and after telbivudine treatment As indicated in Fig 5A and ... ethylenediaminetetraacetic acid (EDTA) Results CD127 expression on memory CD8 T cells was reduced in patients with chronic hepatitis B Ex vivo expression of CD127 by different CD8 T lymphocyte subsets taken...

Ngày tải lên: 12/08/2014, 01:21

... replication poses a serious limitation to current treatments An attractive strategy to circumvent this problem entails targeting host factors that are recruited by the virus to complete its life ... renders the enzyme susceptible to small molecule inhibitors that conform to the steric restrictions imposed by the active site pocket and interact with the metal via bidentate coordination [54] The ... not excluded, these findings strengthen the view that the sensitivity of HIV-1 to CPX and DEF results at least in part from their action on eIF5A maturation How this affects transcription initiation...

Ngày tải lên: 12/08/2014, 23:22

... phosphorylate keratins could provide those cells a resistance to apoptosis This latter interpretation is in agreement with the notion that K8/18 intermediate filaments play a key role in the protection ... showed that HSP70i was present in control hepatocytes However, by immunofluorescence, we did not detect the presence of HSP70i in the cells (Fig 2B) After weeks of treatment, most of the hepatocytes ... data is in agreement with our immunofluorescence study, which showed that HSP70i partly relocalized to the nucleus during the treatment This distribution pattern is typical of the distribution...

Ngày tải lên: 13/08/2014, 13:20

... study contributes to our understanding of recruitment of T cells to the joint in inflammatory arthritis and suggests that in the microenvironment of the joint, dysregulation of functional patterns ... from the joints of patients with JIA by flow cytometric analysis CCL5 protein was detected within T lymphocytes from both blood and synovial fluid without any stimulation, and these were shown to ... synovial T cells, and that this can be rapidly released without new protein synthesis on stimulation We have also demonstrated that several of the features of this inflammatory T cell population within...

Ngày tải lên: 09/08/2014, 07:20

... reaction (RT-PCR) Primers used were as follows: CD11a, 5’CAGCCTGTTGCCTCTGTGAGA-3’ (forward) and 5’-GGCAGCT CCTTGTTTACTCC-3’ (reverse); and CD70, 5’-GGGCGTCTACTTGCTTCA-3’ (forward) and 5’-CCTGCATCCTGGCAACTGC-3’ ... further contributing to the de-repression of these critical auto-immune factors Materials and methods Patients and controls Patient demographics and treatment regimens are shown in Table SLE patients ... physically interacts with RFX1, and is recruited to CD11a and CD70 promoters (a) Anti-SUV39H1 western blots of Jurkat cells (top) and healthy CD4+ T cells (bottom) lysates following immunoprecipitation...

Ngày tải lên: 12/08/2014, 15:22

... primers used in this work are as follows: IL-1b: 5¢-GCTGTGGCAGCTACCTATGTCTTG-3¢ and 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF-a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: ... ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth ... and thus part of the MSCs-CM fraction that inhibited cardiac fibroblast proliferation and collagen synthesis (Fig 1B) To investigate the potential contribution of IL-10 to the paracrine effects...

Ngày tải lên: 18/02/2014, 04:20

... inhibited the expression of FasL In this study, we show that all-trans-RA inhibits FasL expression by blocking transcriptional activation by NFAT Our results suggest the therapeutic potential of targeting ... CBP/p300 between these transcriptional factors might result in the inhibition of the NFAT activity Similarly, the cross-talk between retinoid receptors and NFAT might take place at the protein level, ... independent measurements supporting our contention that RA modulates the transactivation function of NFAT We also cotransfected the NFAT(FasL)-Luc reporter, along with the retinoid receptor expression...

Ngày tải lên: 24/03/2014, 03:21

... Biosciences) The reactivity of CD8+ T cells to WT1 or CEA or both are shown as the percentage of the total population of CD8+ T cells that were double positive (CD8+pentamer+) Cytotoxicity assays The cytotoxicity ... [36,37] The fusion cells could prime naive T cells to differentiate into CTL with lytic activity against the HCC cells (Figure 3A and 3B) After hr coculture of the HCC cells with healthy donor's T cells ... http://www.translational-medicine.com/content/6/1/51 Figure The ability of vaccination with autologous FCs to stimulate T cells The ability of vaccination with autologous FCs to stimulate T cells A, Nonadherent PBMCs obtained before and...

Ngày tải lên: 18/06/2014, 15:20

... AMD patients and healthy subjects in compliance with institutional review board (IRB) protocols after informed consent at the National Institutes of Health (NIH) The written consents were obtained ... human T cells in vitro To study the role of C5a on human CD4 + T cells, we used ELISA and intracellular staining to detect cytokine expression PBMCs from AMD patients and controls were treated with ... monocytes on T cells could be due to either direct interaction between B7.1/B7.2 on monocytes and CD28 on T cells, or indirect effects such as the production of cytokines C5a treatment promoted both...

Ngày tải lên: 18/06/2014, 22:20

... CCT GGA-3' 5'-GAA TTA CCC AGT CCT GGC TT-3' 5'-TCA TAA CTC CAT ATG GCT TGA AC-3' 5'-CTG CCG TGT CGC TCT GCA CTG-3' 5'-GGA TAA ACT GGT AGC CAA CA-3' 5'-TCT TCG TAC TCA TTT GGG AAG CC-3' 5'-TCA TAA ... GTT CTG TC-3' 5'-AAG TCC ATG AAG ACT CAC ACC AT-3' 5'AAG ACA ATC CAC GTG TGG CTC AAG-3' 5'-CGA TTT TTG TAC CAT CTG CAG AAA-3' 5'-GAC ATG AAT GGC AAA TGT GAG AAA C-3' 5'-AGT CTG TGC TGG GGT CTT ... interests The authors declare that they have no competing interests Authors' contributions YY and MS conceived of the study, participated in its design and coordination and drafted the manuscript...

Ngày tải lên: 20/06/2014, 07:20

... 5´-GCTCCCTCTCATCAGTTCCA 3´-CGGAGAGGAGGCTGACTTTC 501 IFNγ 5´-GCGGCTGACTGACTGAACTCAGATTGTAG 3´-GGGATATGTCGACTTTTGACACTG 306 Effects of Benzo[a]pyrene, 2-Bromopropane, Phenol and 2,3,7,8-Tetrachlorodibenzo-p-Dioxin ... β-actin 5´-ATGGTGGGAATGGGTCAGAAG 3´-GGAAGATGTTACTCGACGAGC 169 IL-1β 5´-TGACCCATGTGAGCTGAAAG 3´-GACTTGGCAGAGGACAAAGG 499 IL-6 5´-CCACCCACAACAGACCAGTA 3´-GAGCATTGGAAGTTGGGGTA 498 TNFα 5´-GCTCCCTCTCATCAGTTCCA ... ffects of pollutants on IL-2 production IL-2, the major growth factor of T cells, is mainly produced by CD4 +T cells, and the quantity of IL-2 synthesized by activated T cells is an important determinant...

Ngày tải lên: 07/08/2014, 15:20

... incubated with the antibodies (rabbit IgG) anti-STAT1 antibody, antiphosphorylated tyrosine 701 of STAT1 antibody, antiSTAT3 antibody, and anti-phosphorylated tyrosine 705 of STAT3 antibody, diluted ... phosphorylation and activation of the latent transcription factors R571 Arthritis Research & Therapy Vol No Yamana et al Figure (a) control RA HC p-Tyr-STAT3 HC STAT3 p-Tyr-STAT1 STAT1 (%pSTAT3/STAT3) ... abolished by neutralization of IL-6 activity (Fig 5a) These results indicate that IL-6 is the dominant STAT3-activating factor contained in sera of active RA patients The lack of STAT1 activation by...

Ngày tải lên: 09/08/2014, 01:24