you who are the other members of the community t

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this study Strain Genotype Source EGY48 AMY245 MATa his3 trp1 ... (5¢- to 3¢) Vps4–DEL F Vps4–DEL R Vps4–TRP F Vps4–TRP R Vps4–RDF F Vps4–RDF R TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA ... and the b-domain DEL sequence are important for the interaction of Vps4p with other proteins, we tested the ability of the Vps4p mutant proteins to interact with a set of known Vps4p-interacting...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Báo cáo hóa học: " Members of the Hyposoter didymator Ichnovirus repeat element gene family are differentially expressed in Spodoptera frugiperda" docx

Báo cáo hóa học: " Members of the Hyposoter didymator Ichnovirus repeat element gene family are differentially expressed in Spodoptera frugiperda" docx

... AACGTGGAAACTTTGTCGCC TCGGTGTGCTGATTGTGAGC GCCCCTGCCATTTGAAAAAT CGGCGTGTCACAAACTGTTG GGAAGACCGCCTGCTTATCA AAGGCCAGAAGAAGATCGCC TCGTATCGTTCCACCGGGTA GTTTTGCCCCAATGGTGATG same as rep6 gene GGGTCGCAATGAAGGTGCTA ... CTGGCGAGTGTGTTTGCAAT AY433942 CATCGTGGTGCTCTTCATTGA CAAAGTAAACGTACCGGCCC SF9L03548 (*) SF9L00930 (*) ACTTGTGGCCCGCATACACT TGCCATCGGGAAAATGAAAT GGATCGGCACAATAAATGGG TTCTCTGCACCTTATTGGGTCTC synthesised ... GGGTCGCAATGAAGGTGCTA CGTTCCTGGAGGGACTACCC TCATGTCCCAAGTCACACGG TCGCGAATGCAGTAGCACTG GCTTCAAGATGTTGCCCCATT CCTCCGAATAAAGGCGTCAGT AGAGGCATGAGCCAGTCCC CAGCCAGATGGTGGAAGCTC TGCCACAGTTTTGCTCGAAC same...

Ngày tải lên: 20/06/2014, 01:20

11 352 0
Báo cáo y học: " Ambivalent connections: a qualitative study of the care experiences of non-psychotic chronic patients who are perceived as ‘difficult’ by professionals" docx

Báo cáo y học: " Ambivalent connections: a qualitative study of the care experiences of non-psychotic chronic patients who are perceived as ‘difficult’ by professionals" docx

... which the development of personal contact is most important to patients during the first three stages, and to which substantial treatment is added in the next three stages The stage in between ... certain treatments Also there are unwritten rules, so they say, considering themes that are apparently not appropriate to discuss or These issues are at odds with the involvement participants ... the patient And then the conversations start to dilute into something I can t define any more ( ) Then I have completely lost track There is no structure any more, no So there is little attention...

Ngày tải lên: 11/08/2014, 16:22

11 370 0
Báo cáo khoa học: "Pro/con debate: In patients who are potential candidates for organ donation after cardiac death, starting medications and/or interventions for the sole purpose of making the organs more viable is an acceptable practice" doc

Báo cáo khoa học: "Pro/con debate: In patients who are potential candidates for organ donation after cardiac death, starting medications and/or interventions for the sole purpose of making the organs more viable is an acceptable practice" doc

... be met: the act must not belong to a category of acts considered evil; the good effect (for the patient), and not the bad effect, must be intended; the bad effect must not be a means to the good ... candidates are not competent to consent Families as proxy are not acting in the patient’s autonomous interest in consenting to treatment that will not benefit and may harm the patient, irrespective ... none of these practices benefit the donors, at least not physically, since they will die regardless of the treatment provided Most of the opposition to these practices, however, stems from the...

Ngày tải lên: 13/08/2014, 03:20

4 301 0
the virtual jirga the 2009 education policy and the medium of instruction debate in pakistan who is participating and what are the implications for balochistan

the virtual jirga the 2009 education policy and the medium of instruction debate in pakistan who is participating and what are the implications for balochistan

... address the members of the body This body has the authority to conduct and control the debate without any offence taken After hearing all the parties, the members examine the debate and the witnesses ... marginalised area of Pakistan, which harbours one of the most confrontational separatist movements in recent times The thesis explores the extent to which the concept of the Jirga, the traditional ... and the participants as jurists In terms of the proceedings, the disputant parties present arguments and witnesses They not debate with each other directly; rather, all the parties need to address...

Ngày tải lên: 22/12/2014, 16:41

286 1,7K 0
Safeguarding Public and Environmental Health: What are the Necessary Requirements of UV Reactor Validation Protocols?

Safeguarding Public and Environmental Health: What are the Necessary Requirements of UV Reactor Validation Protocols?

... effect and quantifies it with a safety factor termed the Polychromatic Bias It is important to note that there are two effects layered into this issue If spectra differ between the validation site ... immediately upstream of the UV reactor The USEPA draft UVDGM suggests a similar approach These concepts are based on the premise that the tested conditions are worst case, and that all installation ... is to recognize the dose distribution as the root of this bias, and validate the ability to accurately calculate the dose distribution under different polychromatic conditions Validation of the...

Ngày tải lên: 05/09/2013, 09:08

8 545 0
What are the advantages and disadvantages of supermarkets

What are the advantages and disadvantages of supermarkets

... things they not actually need For many of us the major disadvantage of shopping in supermarkets id that it is time consuming and it takes a while to getthere and back Big stores are also quite dangerous ... private people And those shops may be the only source of living of then To conclude I would like to express my opinion which rather possitive I think that supermarkets are great creatures and the ... free" or "two for the pirce of one" are always found there One the other hand shopping in supermarkets can be annoying beckause there is a big choice which can cause confusion People often buy...

Ngày tải lên: 23/10/2013, 02:15

2 3,3K 4
What are the advantages of being sefl-employed

What are the advantages of being sefl-employed

... understands the implications To the kids it simply means that mommy or daddy is home and should be able to pay attention to them and play with them To the neighbor it may mean the freedom to drop ... you what to you are in total control and you can decide when to work and when not too there are tax advantages too if you compare it to the same job being employed as you can claim all related expenses ... about working long hours, into the wee hours of the night and morning to finish a project on time or perhaps early to impress the client? What about the ability to bite your tongue when a client...

Ngày tải lên: 27/10/2013, 09:15

4 608 0
Tài liệu Do you qualify for the disabilityelement of Working Tax Credit? pdf

Tài liệu Do you qualify for the disabilityelement of Working Tax Credit? pdf

... more, with the last day of receipt falling within the 56 days before you claimed the disability element and your disability is likely to last for at least six months or the rest of your life TC956 ... where the last of those fell within the 56 days before you claimed the disability element (see Note on page 12) and your disability is likely to last for at least six months or the rest of your ... jacket or tucking a shirt into trousers • You cannot extend either of your arms in front of you, as if you were shaking hands with someone, without difficulty • You cannot, without difficulty, put...

Ngày tải lên: 15/02/2014, 14:20

12 407 0
Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc

Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc

... Nevertheless, in the light of current knowledge, most of the phosphorylation events seem to repress the transactivation capacity of HSF1 [52–57] Another post-translational modification, suggested to ... associated with the generation of heterochromatin, and reduced the binding of HSF1 These results show that HSF4 promotes the DNA-binding activity of another member of the HSF family, through modulating ... fascinating 4134 topic is raised by the recent findings that different members of the HSF family are able to interact, both structurally and functionally, thereby impacting the actions of their partners...

Ngày tải lên: 18/02/2014, 04:20

14 549 0
Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt

Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt

... type of interaction, as this has the potential to predict possible protein binding to the BPMs It will also be of importance to define the functional impact of the BPM family on the activity of ... in cotyledons and in the central cylinder of the root, but not in the lower parts of the hypocotyl (a) Rosette leaves were stained in the vascular tissue of the leaf blade, whereas the petiole ... scaffolding subunits of multimeric E3-ligases that can polyubiquitinate their substrates and thereby target them for degradation via the 26S proteasome [17] Thus, plant BTB ⁄ POZ proteins potentially serve...

Ngày tải lên: 18/02/2014, 06:20

12 657 0
Tài liệu Country Cooperation Strategy for WHO and the Republic of Yemen 2008–2013 pdf

Tài liệu Country Cooperation Strategy for WHO and the Republic of Yemen 2008–2013 pdf

... on the primary health care approach The key element of the reform is the establishment of a district health system where other elements such decentralization, community participation and intersectoral ... constitute about one third of the 2.9% of the population that are disabled With a blindness rate estimated at 1.5%, Yemen is among the seven countries in the Eastern Mediterranean Region with the ... directed at tackling the harmful effects of khat Strengthening the mental health programme with focus on quality of care and integration of mental health in the primary health care Assisting the government...

Ngày tải lên: 18/02/2014, 15:20

64 397 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... expression of PDGF-D, -B and the PDGFRs was detected in the interstitial fibroblasts, in contrast to the interstitial cells of normal kidney The PDGFR-b protein was distributed in the tubointerstitial ... domain shares 27–35% sequence identity with the rest of the PDGF ⁄ VEGF family [8], and with specific reference to the other three PDGFs the identity is nearly 25% [20] The growth factor domains of ... both the amount of macrophages in the dermis and the interstitial fluid pressure [87] The PDGF-D-mediated elevation of interstitial fluid pressure is consistent with PDGFR-b being essential for the...

Ngày tải lên: 19/02/2014, 07:20

19 558 0
Tài liệu Báo cáo Y học: Short peptides are not reliable models of thermodynamic and kinetic properties of the N-terminal metal binding site in serum albumin doc

Tài liệu Báo cáo Y học: Short peptides are not reliable models of thermodynamic and kinetic properties of the N-terminal metal binding site in serum albumin doc

... spectra of HSA complexes are intermediate between those of DAHam and DAHKam, suggesting that the conformation of the chelate system in the protein is also intermediate between these two models The ... literature data The binding afnities for the model peptides are in the middle of the range of values for both Cu(II) and Ni(II) Note that the variation of side chain substituents can result in ... NMR studies of the Ni(II) complex of HSA [6] Due to different protonation patterns, the stability constants of particular complexes of model peptides cannot be compared directly There are two...

Ngày tải lên: 22/02/2014, 04:20

9 628 0
Who Are America’s Poor Children? Examining Health Disparities Among Children in the United States ppt

Who Are America’s Poor Children? Examining Health Disparities Among Children in the United States ppt

... the federal Department of Health and Human Services awarded the initial $88 million of these funds to support efforts in the 49 states, the District of Columbia, and the five territories that ... within the past days Heavy drinking within the past 30 days Source: National Health Statistics Reports, 2009 Health Outcomes Each of the preceding domains is important to the extent that it affects ... Petersen, P E 2003 The World Oral Health Report 2003: Continuous Improvement of Oral Health in the Twenty-first Century: The Approach of the WHO Global Oral Health Programme Community Dentistry...

Ngày tải lên: 05/03/2014, 12:20

16 451 0
A RIP VAN WINKLE OF THE KALAHARI AND OTHER TALES OF SOUTH-WEST AFRICA doc

A RIP VAN WINKLE OF THE KALAHARI AND OTHER TALES OF SOUTH-WEST AFRICA doc

... anticipation of an early start, but the other pack was lying there in the dunes And thus I awaited the abatement of the storm, a prey to the most awful suspense Inyati! There in the distant dunes ... into the open country, past the huge flat-topped mountains of Ombokoro, the fastness of the Berg Damaras, thence following the dry river-bed of the Om- Mafako north-east to the confines of the ... DEAD" THE WATERS OF ERONGO PREFACE MOST of these stories were written on the veldt; at odd times, in out- of -the- way prospecting camps, in the wilds of the Kalahari Desert, or of that equally little-known...

Ngày tải lên: 06/03/2014, 03:21

160 619 1
Báo cáo khoa học: Differential recognition of heat shock elements by members of the heat shock transcription factor family ppt

Báo cáo khoa học: Differential recognition of heat shock elements by members of the heat shock transcription factor family ppt

... that the members of the hHSF family differentially recognize HSEs, and suggest that the regulated expression of different hHSF target genes is dependent upon the architecture of the HSE HSE-type ... viability function of yHSF, because its trimer formation is inhibited at normal growth temperatures [28] Mutant forms of hHSF1 that can trimerize in the absence of stress are able to substitute for ... detected by treatment of wild-type hHSF4–VP16 with EGS The L140P and I186P substitutions appeared to inhibit trimer formation, and most of the polypeptides migrated at the position of a monomer...

Ngày tải lên: 07/03/2014, 00:20

13 508 0
Báo cáo khoa học: Saccharomyces cerevisiae Ybr004c and its human homologue are required for addition of the second mannose during glycosylphosphatidylinositol precursor assembly ppt

Báo cáo khoa học: Saccharomyces cerevisiae Ybr004c and its human homologue are required for addition of the second mannose during glycosylphosphatidylinositol precursor assembly ppt

... together, these results are strong evidence that lipid 004–1 contains EthN-P, and therefore that 004–1 contains at least one mannose residue We next compared the TLC mobility of lipid 004–1 to ... at 25 °C genetically in that at least one gene’s product has been implicated in all but one of the predicted reactions in the GPI pathway The exception is the addition of the second mannose to ... tests place Ybr004cp in the GPI biosynthetic pathway To obtain genetic evidence that YBR004c functions in the GPI biosynthetic pathway, the epistasis relationships to genes upstream and downstream...

Ngày tải lên: 07/03/2014, 16:20

9 398 0
Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe pdf

Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe pdf

... [25], all attempts to activate S pombe Ntp1p in vitro have been unsuccessful to date Taken together, these results support the idea that in S pombe the regulation of Ntp1p activity under stress relies ... relies on the existence of some kind of interaction between Ntp1p and Tps1p, or other elements, that may be lost under the conditions of the in vitro assay for activation In the present work, we ... fact is that there is a small but reproducible shift in the elution behavior of trehalase depending on the nature of the activation stress (Fig 5B) This shift might argue against the participation...

Ngày tải lên: 08/03/2014, 23:20

9 428 0
w