x ray of the stomach showing a small ulcer
báo cáo khoa học: "Thick calcification from a GIST of the stomach penetrating into pericolic soft tissue - report of a case" pptx
Ngày tải lên :
09/08/2014, 01:24
... undertook the literature research BA and PC performed the histological studies PS and PD performed the data and statistical analysis PS prepared the manuscript All authors read and approved the final ... genesis, and yet another of many emerging roles of the interstitial cell of Cajal in the pathogenesis of gastrointestinal disease Adv Anat Pathol 1999, 6:19-40 Miettinen M, Sarlomo-Rikala M, Lasota ... appropriate, were recorded Statistical analysis was performed using SPSS 12.0 software (Chicago, IL, USA) Overall actuarial survival was calculated from the day of surgery until death or the last day...
- 4
- 296
- 0
báo cáo khoa học: "A rare case of xanthogranuloma of the stomach masquerading as an advanced stage tumor" ppt
Ngày tải lên :
09/08/2014, 02:20
... Retroperitoneal xanthogranuloma Am J Cancer 1935, 23:477-489 Zafisaona G: Inflammatory fibrous histiocytoma of the stomach Apropos of a case of xanthogranuloma? Arch Anat Cytol Pathol 1987, 35:149-153 Zhang ... Aikawa M, Ishii T, Nonaka K, Nakao M, Ishikawa K, Arai S, Kita H, Miyazawa M, Koyama I, Motosugi U, Ban S: A case of gastric xanthogranuloma associated with early gastric cancer Nippon Shokakibyo ... abdominal wall, and a defined abdominal mass was palpable on physical examination Therefore, the tumor was recognized as an advanced gastric cancer Biopsy of the elevated lesion should have been carried...
- 3
- 239
- 0
Báo cáo khoa học: "Intramucosal leiomyosarcoma of the stomach following hereditary retinoblastoma in childhood – a case report and review of the literature" doc
Ngày tải lên :
09/08/2014, 07:22
... unique intramucosal leiomyosarcoma of the stomach and the first gastric leiomyosarcoma described in a survivor of a retinoblastoma in childhood Because of the young age of the patient, the high ... hereditary retinoblastoma of the eye [4] A leiomyosarcoma in the maxillofacial region, followed by a chorioncarcinoma years later, was described in a long-term follow up after treatment of a bilateral ... 12:464-468 Liang SX, Lakshmanan Y, Woda BA, Jiang Z: A high-grade primary leiomyosarcoma of the bladder in a survivor of retinoblastoma Arch Pathol Lab Med 2001, 125(9):1231-1234 Venkatraman L, Goepel...
- 5
- 573
- 0
Báo cáo y học: "Immunohistological assessment of the synovial tissue in small joints in rheumatoid arthritis: validation of a minimally invasive ultrasound-guided synovial biopsy procedure" potx
Ngày tải lên :
09/08/2014, 10:21
... true sample mean the mean area fraction for the particular tissue marker being examined It can be seen that the analysis of a cumulative area of 2.5 mm2 (randomly selected from all available samples) ... fraction of the total sampling population used to create the area fraction calculation increases), the proximity of the sample mean to the overall mean area fraction is asymptotic The number of HPFs ... examined increases, the difference between the sampling mean and the overall mean reduces A threshold value of 10% of the overall mean (arrows) was set as providing a reasonable estimator of the...
- 9
- 430
- 0
báo cáo khoa học: " Primary adenocarcinoma of the stomach in von Recklinghausen’s disease with high serum levels of multiple tumor markers: a case report" ppsx
Ngày tải lên :
10/08/2014, 23:20
... Internal Medicine, Okayama University, 2-51 Shikata Town, Okayama City, Okayama, 700-8558, Japan 6Department of Surgery, Asahikwa Medical College, 1-1, 2-1 Midorigaoka, Asahikawa, 0788510, Japan ... Cyome Nakamachi, Pippu Town Kamikawa-gun, Hokkaido, 078-0343, Japan 2Department of Surgery, Asahikawa Medical Center, 4048, Cyome Hanasaki-cyou, Asahikawa, 0708644, Japan 3Department of Surgery, ... few cases have explored the association of primary infiltrating adenocarcinoma of the stomach [5] It has been indicated that loss of function of the NF-1 gene results in peripheral neurofibromatosis...
- 5
- 330
- 0
Báo cáo y học: " Malignant melanoma of the stomach presenting in a woman: a case report" potx
Ngày tải lên :
11/08/2014, 00:22
... Endoscopic images of gastric metastasis of the malignant melanoma Page of Figure Endoscopic images of duodenal metastasis of the malignant melanoma stomach, liver, lungs and bones Stomach metastasis ... (MART-1): A new monoclonal antibody for malignant melanoma diagnosis Page of terminal metastasis It has been reported that almost all the areas of the human body can be affected by melanoma metastases ... Palanivelu C, Mathew S, Rajan PS, Jani K, Senthilkumar R, Senthilkumaran S, Kavalkat AJ: Malignant melanoma metastatic to the stomach and duodenum Indian J Gastroenterol 2005, 24(3):133 Kanthan...
- 4
- 351
- 0
Báo cáo y học: "Inflammatory fibroid polyp of the ileum presenting with small bowel obstruction in an adult patient: a case report" pps
Ngày tải lên :
11/08/2014, 03:21
... presence of distinct malignancy and the local factors such as the degree of associated edema, and relative ischemia of the involved bowel A wedge resection of affected bowel segment was performed ... submucosa as a solitary or sessile lesion with an inflammatory basis They can occur throughout the intestinal tract but most frequently in the gastric antrum and small bowel [3] IFPs usually measure ... [2] About 70% to 90% of intussusception cases are due to benign or malignant neoplasms as a lead point and IFPs, lipomas and adenomas are the benign causes of intussusception [7] However, it has...
- 4
- 379
- 0
Báo cáo y học: "Inflammatory fibroid polyp of the ileum presenting with small bowel obstruction in an adult patient: a case report" pdf
Ngày tải lên :
11/08/2014, 07:20
... presence of distinct malignancy and the local factors such as the degree of associated edema, and relative ischemia of the involved bowel A wedge resection of affected bowel segment was performed ... submucosa as a solitary or sessile lesion with an inflammatory basis They can occur throughout the intestinal tract but most frequently in the gastric antrum and small bowel [3] IFPs usually measure ... [2] About 70% to 90% of intussusception cases are due to benign or malignant neoplasms as a lead point and IFPs, lipomas and adenomas are the benign causes of intussusception [7] However, it has...
- 4
- 541
- 0
Báo cáo y học: " Small cell neuroendocrine tumor of the breast in a 40 year-old woman: a case report" pps
Ngày tải lên :
11/08/2014, 12:20
... Hamati HF: Primary small cell anaplastic carcinoma of the breast, diagnosis by fine needle aspiration cytology: a case report Acta Cytol 1998, 42:1199-1203 Yamasaki T, Shimazaki H, Aida S, Tamai ... argyrophil variant of lobular carcinoma of the breast Lobular carcinoma is always negative for Caderin E, whereas SCNC is positive in 100% of cases as in this situation Our patient was treated with ... S, Tamaki K, Hiraide H, Mochizuchi H, Matsubara O: Primary small cell (oat cell) carcinoma of the breast: report of a case and review of the literature Histopathology 2001, 38:277-278 10 Salmo...
- 3
- 302
- 0
Báo cáo y học: "Delayed diagnosis of intermittent mesenteroaxial volvulus of the stomach by computed tomography: a case report" ppt
Ngày tải lên :
11/08/2014, 19:21
... scan (Fig 3) performed 19 days after admission finally revealed mesenteroaxial volvulus of the stomach At laparotomy the next day, rotation of the proximal twothirds of the stomach around an adhesion ... adhesions, diaphragmatic or hiatal hernias), (4) exclusion of other extra-gastric or vascular causes of gastric ischaemia As with upper GI con- Figure Diagrammatic representation of mesenteroaxial volvulus ... classified as any of the former [4] Figure (A) Supine abdominal radiograph showing a dilated spherical gastric shadow (A) Supine abdominal radiograph showing a dilated spherical gastric shadow (B)...
- 6
- 322
- 0
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh
Ngày tải lên :
05/09/2013, 09:08
... canal and ponds It was partly because the people had considered the biogas plant as maintenance free and they did not any maintenance at all with lack of the appropriate technical knowledge Also, ... populated countries of the world, with a population of about 129 million in 2001(Bangladesh Bureau of Statistics, 2002) Dhaka is the capital city of Bangladesh, and Bauniabad is one of the urban ... and water quality analysis of the biogas plants were conducted BACKGROUND Study area Bangladesh lies in the northeastern part of South Asia, and has an area of 147,570 km2 It is one of the most...
- 9
- 971
- 0
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
Ngày tải lên :
20/12/2013, 23:15
... its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments, ... registration are unrelated to those listed in the application The Examining Attorney again found these arguments unpersuasive, and he issued an Office Action to that effect The Board instituted the ... instituted the appeal and both applicant and the Examining Attorney filed briefs Applicant did not request an oral hearing before the Board Accordingly, we have considered this appeal based on the written...
- 8
- 416
- 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
Ngày tải lên :
19/02/2014, 05:20
... corresponds to change of absorbance at wavelength 352 nm in the reaction sample after incubation time t; DAmax ẳ jACNCbl AH2 OCbl j stands for maximal poss352 ible change in the amplitude at wavelength, ... the reaction as a unidirectional process and t it by exponential approximation Surprisingly, the mono-exponential t was quite inadequate (dotted line, Fig 5A) , and the data were analysed by a double-exponential ... Cbl, calculation of k+ We have tested the application of the uorescent analogue CBC as a tool for investigation of the binding kinetics of nonuorescent ligands Cyano-cobalamin (CNCbl) was examined...
- 12
- 603
- 0
Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx
Ngày tải lên :
19/02/2014, 12:20
... GGTTGCCTGAGRTGYATHTGa GGGCTATTGGTCAGACGCTACACTC GAGTGTAGCGTCTGACCAATAGCC GATCTGATACGGTCCACACGACAG GCLRCIC GYWSDATL GYWSDATL LSCGPYQI H ¼ A or C or T; R ¼ A or G; Y ¼ C or T transcription The cDNA was ... in the above paragraph The cDNA sequence agreed with the protein sequence without ambiguity (Fig 2) and allowed confirmation of the data from the biochemical analysis in two cases when an overlapping ... the bivalve Tapes japonica [3], with the so-called chlamysin of Chlamys islandica [4,5], and also with a hypothetical secreted protein of the nematode Caenorhabditis elegans and with putative...
- 6
- 737
- 0
Research Program of the Partnership for a New Generation of Vehicles doc
Ngày tải lên :
06/03/2014, 15:20
... OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering ... Laboratory, Lawrence Berkeley National Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National ... technical area is a major collaborative effort of the individual partners, the national laboratories, and a few universities The Pacific Northwest National Laboratory, Lawrence Livermore National Laboratory,...
- 134
- 466
- 0
Apollonius of Tyana, the Philosopher-Reformer of the First Century A.D. potx
Ngày tải lên :
07/03/2014, 03:20
... of Xerxes; they invaded Thessaly and fought at Plataea From the time of Alexander onwards there was direct and constant contact between [ =A] ry[ =a] varta and the kingdoms of the successors of the ... rejection of mythology in favour of a physical explanation of natural phenomena Such, for instance, are his explanations of the volcanic activity of AEtna (v 14, 17), and of a tidal wave in Crete, the ... was initiated four years later (iv 18; v 19) While at Athens Apollonius spoke strongly against the effeminacy of the Bacchanalia and the barbarities of the gladiatorial combats (iv 21, 22) The...
- 61
- 493
- 0
Báo cáo khoa học: Mathematical modelling of the urea cycle A numerical investigation into substrate channelling docx
Ngày tải lên :
08/03/2014, 08:20
... effect is ascribed to the high catalytic capacity (Vmax) of the arginase Relevant Mathematica functions were written to extract the distribution of radioactivity, and the total measurable radioactivity ... activity of the carbamoyl phosphate produced in the matrix is the same as that of the bicarbonate, only small changes are predicted in the distribution of labelled cytoplasmic urea cycle intermediates ... a more advanced and realistic model of the urea cycle than has been available hitherto The model affords a means of studying the kinetic consequences of enzyme and metabolite compartmentalization...
- 9
- 438
- 0
Adventurers of the Far North A Chronicle of the Frozen Seas doc
Ngày tải lên :
08/03/2014, 15:20
... Lake; Hearne speaks of it as Athaspuscow Lake The latter name is the same as that now given to another lake (Athabaska of Canadian maps) the word being descriptive and meaning the lake with the beds ... fresh water far beyond the basin of the Saskatchewan and the Columbia emptied towards the north Hearne had revealed the existence of the Great Slave Lake, and the advance of daring fur-traders ... northern seas The eastern passage, from the German Ocean round the top of Russia and Asia, was first attempted As early as the reign of Edward the Sixth, a company of adventurers, commonly called...
- 54
- 472
- 0
Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx
Ngày tải lên :
08/03/2014, 19:20
... FEMA Federal Emergency Management Agency INEEL Idaho National Engineering and Environmental Laboratory NASA National Aeronautics and Space Administration NIST National Institute of Standards and ... to obtain data on the nature of extreme winds New projects are being initiated by the National Oceanic and Atmospheric Administration (NOAA), the DOE, the National Institute of Standards and Technology, ... Engineering Institute of Canada; Golden Plate Award, American Academy of Achievement; International Award of Merit in Structural Engineering, International Association of Bridge and Structural Engineering;...
- 49
- 588
- 0
Guy Fawkes or A Complete History Of The Gunpowder Treason, A.D. 1605 pot
Ngày tải lên :
08/03/2014, 22:20
... gentleman At this stage of the examination, the lord chamberlain saw a man standing in a corner of the cellar, who stated that he was Percy's servant, and that he was left by his master in charge of ... merely to an attempt, on the part of the Romanists, at the commencement of the session, to obtain a toleration for their worship, and the relaxation of some of the penal laws Various attempts have ... by almost all the papal sovereigns of Europe A remarkable circumstance is related of the hopes and intentions of the Spaniards, in the event of success in the Armada A Spanish officer, who was...
- 74
- 422
- 0