... test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in turn The class ... driven” (Brown) in that they focus on the overall meaning of a passage, and the application of schemata Schemata are mental frameworks based on past experiences whish can be applied to help us ... for this task must have quite easy language and sung at a low speed such as ‘ whatever will be will be’ To carry out this task, teacher can omit some passage of the song word and then ask students...
Ngày tải lên: 29/01/2014, 10:33
Research " COMTETING UPSTREAM: INBOUND LOGISTICS AS A SOURCE OF COMPETITIVE ADVANCE " potx
Ngày tải lên: 07/03/2014, 02:20
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
... NSAIDs and enan- 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 tiomers of flurbiprofen target gamma-secretase and lower Abeta 42 in vivo J Clin Invest 20 03, 1 12: 440-449 Nimmerjahn A, ... complex and the initiation of intracellular signaling events regulating oxidase assembly and activation has been described [31, 32] The NADPH oxidase The phagocytic NADPH oxidase plays an essential ... systematic review and meta-analysis of observational studies Bmj 20 03, 327 : 128 Stewart WF, Kawas C, Corrada M, Metter EJ: Risk of Alzheimer's disease and duration of NSAID use Neurology 1997, 48: 626 -632...
Ngày tải lên: 19/06/2014, 22:20
examining linguistic ambiguity as a source of constructing funniness in english verbal jockes = khảo sát hiện tượng mơ hồ ngôn ngữ với vai trò là một nguồn tạo nên tính hài hước của các câu chuyện tếu tiếng anh
... conveying at least two incompatible interpretations- “having more than one sense” as stated by Hurford and Heasley (20 01: 121 ) -9- Regarding paraphrasing, Hurford and Heasley (20 01) assert that a word ... Types of linguistic ambiguity in English 2. 2 English verbal jokes 2. 2.1 The notion of Humor 2. 2 .2 What counts as “verbal jokes”? 11 11 12 2 .2. 2.1 Definitions of verbal jokes 12 2 .2. 2 .2 Types of ... (2) in chapter in fact is a typical example of this (2) A man eating a kebab goes up to a lady who has a yapping Chihuahua at her heels “Can I throw your dog a bit?” he asked politely “Certainly,”...
Ngày tải lên: 02/03/2015, 14:32
Food as a Source of Dioxin Exposure in the Residents of Bien Hoa City, Vietnam
... 0.94 3.3 40 74 2. 9 0.95 68 Channa Striata—snakehead Anabas Testudineus— climbing perch Clarias Fuscus— catfish Clarias Fuscus— catfish Ostechilus Hasselti— carp TABLE Comparison of Highest Dioxin ... Channa Striata—snakehead Fish 2: Anabas Testudineus— climbing perch Fish 3: Clarias Fuscus— catfish Fish 4: Clarias Fuscus— catfish Fish 5: Ostechilus Hasselti— carp ND—nondetected, limit of ... 5605 48 26 823 68099 0.68 2. 4 87 5.3 129 969 36 6115 8003 Fish 1: Channa Striata—snakehead Fish 2: Anabas Testudineus— climbing perch Fish 3: Clarias Fuscus— catfish Fish 4: Clarias Fuscus— catfish...
Ngày tải lên: 27/06/2016, 20:28
A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2
... Frame of Reference for Languages EFL English as a Foreign Language ESL English as a Second Language FLF Foreign Language Faculty HPU2 Hanoi Pedagogical UniversityNo2 ULIS University of Languages and ... International Studies VNU Vietnam National University vi LIST OF TABLES AND FIGURES LIST OF TABLES Page Table 2. 1 Writing V assessment criteria 21 Table 2. 2 Writing portfolio evaluation criteria 22 ... overview of assessment II .2. 1 Definition of assessment There are many definitions of assessment which are listed as follows: According to Assessing Academic Programs in Higher Education (20 04), assessment...
Ngày tải lên: 16/07/2015, 07:45
BÀI LUẬN TIẾNG ANH HAY nuclear energy write about the pros and cons of using nuclear energy as a energy source
Ngày tải lên: 20/08/2015, 00:37
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... (Santa Cruz, CA, USA); anti-MEK2 (ab 325 17), anti-MEK1 (ab 320 91), anti-Raf1 (ab18761), anticalreticulin (ab2907), anti-GM130 (ab 526 49), anti-RSK1 p90 (ab 321 14), anti-N-cadherin (ab1 820 3) and anti-GAPDH ... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... by RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1 -2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢;...
Ngày tải lên: 22/03/2014, 16:20
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... IL2RA gene are associated with age at diagnosis in late-onset Finnish type diabetes subjects Immunogenetics 20 10, 62: 101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi ... [22 ] Candidate-gene approaches have also demonstrated a role for the Idd3 locus in human celiac disease and RA [25 ], as well as in T1D [26 ,27 ] Interestingly, neither the Idd3 locus, nor any of ... pattern [24 ] As such, the presence of a proline rather than a serine at position of the mature IL -2 protein, is associated with an increased glycosylation and prolongation of the IL -2 half life [24 ]...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
... draft training program was revised and finalised accordingly GAP Workshop in Binh Thuan (21 -22 /7 /20 08) Baseline survey Farmers’ opinion towards the cashew IPM program using weaver ants as a major ... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were ... species of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly...
Ngày tải lên: 21/06/2014, 05:20
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
... has designated cashew development as a national priority Productivity of cashew has increased since 20 02, but the extensive use of pesticides has caused health problems to farmers, their animals ... community baseline surveys A total of major cashew-growing provinces, which have 300,700 of cashew, accounting for 86% of the total cashew areas in Vietnam will be targeted Progress to Date Based on ... same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data obtained...
Ngày tải lên: 21/06/2014, 06:20
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf
... are at least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly show that ... play a very important part in cashew production Table shows that 8% of cashew orchards are managed by women, 70% are jointly managed by men and women and 22 % by men The women have had an average ... knowledge of cashew insect pests and diseases and their natural enemies, and Weaver ant status and farmers’ opinion of them The results are summarised below A total of 21 2 cashew farmers were...
Ngày tải lên: 21/06/2014, 06:20
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf
... has designated cashew development as a national priority Productivity of cashew has increased since 20 02, but the extensive use of pesticides has caused health problems to farmers, their animals ... orchard management Comments on practice Average ranks 1.5 2. 0 2. 1 2. 6 16 Amount of time for teaching & discussion 2. 3 Amount of time for field practice 2. 6 Balance of theoretical and practical ... make them aware of the existence and the role of natural enemies (especially weaver ants) on cashew trees, and (3) to provide them with information about the advantages and disadvantages of using...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt
... farmer’s plot and the IPM plot at Binh Phuoc province, Vietnam Farmer IPM 22 23 31 23 23 23 23 23 24 12 Dec Jan Jan Feb Feb Mar Mar Apr Apr Apr May May Jun Jun Jul Dec Jan Jan % shoots with aphids ... bugs 40 30 Farmer 20 IPM 10 22 23 31 23 23 23 23 23 Jul 24 12 Dec Jan Jan Feb Feb Mar Mar Apr Apr Apr May May Jun Jun Dec Jan Jan % shoots damaged by shoot borer | 06 | - 20 07 ... 140 120 100 80 60 40 20 23 Jan 31 Jan 23 23 Feb Feb Mar Mar Apr Apr 23 23 Apr May May Jun 23 Jul 14 24 Jun Nov Dec Jan 12 Jan | -20 07 | -20 08 | Fig Average weaver...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx
... examinations Each of them was awarded a graduation certificate in the cashew IPM training Now, we have 1 12 TOT cashew IPM trainers, and they are distributed in ten cashew growing provinces (Table ... their understanding of the cashew IPM program A lot of farmers said that it was the best training they had received about cashews Although weaver ants are abundant, the farmers never knew about their ... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 20 06...
Ngày tải lên: 21/06/2014, 06:20
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt
... Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has increased since 20 02, but the ... program using weaver ants as a major component - Manual for ICI program trainers and extension officers in Vietnam” As planned, the manual includes up-to-date information about • cashew botany, ... Nông Dong Nai Ba Ria – Vung Tau Binh Thuan Ninh Thuan Tay Ninh Tra Vinh Total 19 19 12 20 16 4 113 25 13 20 10 98 Number of graduated FFS farmers 625 125 325 20 0 498 25 0 20 0 125 100 24 48 29 100 80...
Ngày tải lên: 21/06/2014, 06:20
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt
... government has designated cashew development as a national priority Productivity of cashew has been increased since 20 02, but the extensive use of pesticides has caused health problems to farmers, ... started Baseline data of the insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration orchards has ... important natural enemies were weaver ants (Oecophylla smaragdina) and crametogaster ants (Crematogaster sp) The effect of these two species of ants on cashew flushing shoots damaged by the three major...
Ngày tải lên: 21/06/2014, 06:20
Báo cáo khoa học: "Bony metastases from breast cancer - a study of foetal antigen 2 as a blood tumour markerl" doc
... patients with both skeletal and extra-skeletal metastases FA -2 Assays The serum samples were transported at -20 °C to the Williamson Laboratory at St Bartholomew's Hospital FA -2 radioimmunoassays ... normal women and this was due to marked elevation in women with metastatic breast cancer (Table 2) Women with metastatic disease had a much higher value of FA -2 than those without (Table 3) and ... bony metastases These preliminary data point out that FA -2 is a potential helpful blood marker for bony metastases from breast cancer It would therefore appear that serum FA -2 measurement may be...
Ngày tải lên: 09/08/2014, 03:21